Incidental Mutation 'R1495:Fam227a'
ID 168810
Institutional Source Beutler Lab
Gene Symbol Fam227a
Ensembl Gene ENSMUSG00000042564
Gene Name family with sequence similarity 227, member A
Synonyms 4933432B09Rik
MMRRC Submission 039546-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R1495 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 79493777-79543157 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 79510446 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 403 (V403I)
Ref Sequence ENSEMBL: ENSMUSP00000155261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109646] [ENSMUST00000109648] [ENSMUST00000187519] [ENSMUST00000191401] [ENSMUST00000229064] [ENSMUST00000230366]
AlphaFold Q9D3V8
Predicted Effect probably benign
Transcript: ENSMUST00000109646
AA Change: V51I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105273
Gene: ENSMUSG00000042564
AA Change: V51I

DomainStartEndE-ValueType
low complexity region 156 175 N/A INTRINSIC
low complexity region 204 211 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109648
AA Change: V407I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105275
Gene: ENSMUSG00000042564
AA Change: V407I

DomainStartEndE-ValueType
Pfam:FWWh 134 295 1.4e-51 PFAM
low complexity region 512 531 N/A INTRINSIC
low complexity region 560 567 N/A INTRINSIC
low complexity region 599 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187519
AA Change: V407I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139524
Gene: ENSMUSG00000042564
AA Change: V407I

DomainStartEndE-ValueType
Pfam:FWWh 132 295 1e-47 PFAM
low complexity region 512 531 N/A INTRINSIC
low complexity region 560 567 N/A INTRINSIC
low complexity region 599 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191401
Predicted Effect probably benign
Transcript: ENSMUST00000229064
AA Change: V403I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000230366
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230475
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230429
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,614,356 (GRCm39) N488S probably benign Het
Acot10 G A 15: 20,665,593 (GRCm39) R383C probably damaging Het
Acsm2 A G 7: 119,177,349 (GRCm39) D263G probably damaging Het
Adcy2 G T 13: 68,944,654 (GRCm39) Q243K probably benign Het
Aggf1 G A 13: 95,492,921 (GRCm39) R563* probably null Het
Agt A G 8: 125,286,194 (GRCm39) F296S probably damaging Het
Akap14 T C X: 36,427,618 (GRCm39) D39G possibly damaging Het
Akt3 T C 1: 176,930,608 (GRCm39) M117V probably benign Het
Ankar T C 1: 72,682,450 (GRCm39) T1154A probably benign Het
Arvcf T A 16: 18,207,251 (GRCm39) L70Q probably damaging Het
Ccdc171 A T 4: 83,599,332 (GRCm39) K724* probably null Het
Ccdc91 A G 6: 147,435,670 (GRCm39) T85A possibly damaging Het
Ccdc9b T G 2: 118,591,013 (GRCm39) K173N probably damaging Het
Cdh3 C T 8: 107,265,629 (GRCm39) T224I probably damaging Het
Clstn3 T C 6: 124,426,876 (GRCm39) I482V probably benign Het
Cnot9 A G 1: 74,562,759 (GRCm39) E176G probably damaging Het
Cntnap4 T G 8: 113,608,395 (GRCm39) L1272V possibly damaging Het
Cyb5a T A 18: 84,869,605 (GRCm39) M1K probably null Het
Cyp2c23 A G 19: 43,993,947 (GRCm39) I473T probably benign Het
Dbil5 T A 11: 76,109,276 (GRCm39) M60K probably benign Het
Defa38 T A 8: 21,585,217 (GRCm39) Q75L probably benign Het
Dgkg A T 16: 22,319,129 (GRCm39) L644Q probably damaging Het
Disp3 T C 4: 148,334,282 (GRCm39) I1004V probably benign Het
Egf T A 3: 129,506,655 (GRCm39) I599F probably damaging Het
Epc2 A G 2: 49,426,675 (GRCm39) T145A probably damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,084,988 (GRCm39) probably benign Het
Extl3 A T 14: 65,313,316 (GRCm39) V622E probably benign Het
Fat2 T A 11: 55,153,499 (GRCm39) D3571V probably benign Het
Fcho2 A G 13: 98,886,358 (GRCm39) probably null Het
Fras1 A G 5: 96,676,445 (GRCm39) N64S possibly damaging Het
Gabbr1 A G 17: 37,366,832 (GRCm39) N352S possibly damaging Het
Gabra1 T C 11: 42,045,771 (GRCm39) N113S probably damaging Het
Glg1 T C 8: 111,924,307 (GRCm39) Y227C probably damaging Het
Gm5141 A T 13: 62,922,084 (GRCm39) C362S probably damaging Het
Gprc6a T A 10: 51,504,533 (GRCm39) T104S probably benign Het
Jph1 A C 1: 17,161,876 (GRCm39) V262G probably benign Het
Kank1 C G 19: 25,387,713 (GRCm39) T434R probably damaging Het
Kmt2e A G 5: 23,704,325 (GRCm39) S1173G possibly damaging Het
Krt75 G A 15: 101,482,308 (GRCm39) probably benign Het
Lyzl1 G T 18: 4,181,192 (GRCm39) W77L probably null Het
Nipbl T G 15: 8,380,764 (GRCm39) N676T probably benign Het
Obscn C T 11: 58,970,986 (GRCm39) S2300N probably damaging Het
Or9a2 T G 6: 41,748,837 (GRCm39) Y132S probably damaging Het
Osbpl1a T A 18: 12,891,896 (GRCm39) M350L probably benign Het
Pecam1 T C 11: 106,579,682 (GRCm39) D460G probably damaging Het
Pik3c2a T A 7: 115,987,300 (GRCm39) K540N probably benign Het
Prdm12 T A 2: 31,530,205 (GRCm39) I32N probably damaging Het
Prkd1 T C 12: 50,413,135 (GRCm39) S679G probably damaging Het
Psen2 C T 1: 180,056,419 (GRCm39) A393T probably damaging Het
Ptprh T A 7: 4,583,888 (GRCm39) T235S probably benign Het
Ranbp3 C T 17: 57,012,527 (GRCm39) P182L probably benign Het
Serpinb7 A T 1: 107,379,390 (GRCm39) K266* probably null Het
Sesn3 T C 9: 14,219,817 (GRCm39) S69P probably damaging Het
Slc12a6 T C 2: 112,184,535 (GRCm39) M818T probably damaging Het
Slc25a53 C A X: 135,916,084 (GRCm39) C4F unknown Het
Snx1 T A 9: 66,003,879 (GRCm39) L255F probably benign Het
Sptbn2 T G 19: 4,769,004 (GRCm39) S46A possibly damaging Het
Taf4 A G 2: 179,574,820 (GRCm39) F595S probably damaging Het
Tec A T 5: 72,944,098 (GRCm39) V103E probably damaging Het
Tmco5b T C 2: 113,121,136 (GRCm39) S147P possibly damaging Het
Uchl5 C T 1: 143,675,675 (GRCm39) T93I possibly damaging Het
Usp14 A T 18: 10,004,994 (GRCm39) S225T probably benign Het
Usp45 C A 4: 21,797,385 (GRCm39) Q238K possibly damaging Het
Vmn1r6 T A 6: 56,980,058 (GRCm39) M218K possibly damaging Het
Zfp84 T A 7: 29,476,728 (GRCm39) Y473* probably null Het
Zyg11b G A 4: 108,123,410 (GRCm39) P186S probably damaging Het
Other mutations in Fam227a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01650:Fam227a APN 15 79,518,274 (GRCm39) missense possibly damaging 0.66
IGL01807:Fam227a APN 15 79,533,856 (GRCm39) missense probably benign 0.03
IGL01936:Fam227a APN 15 79,496,747 (GRCm39) missense possibly damaging 0.90
IGL02355:Fam227a APN 15 79,528,139 (GRCm39) intron probably benign
IGL02362:Fam227a APN 15 79,528,139 (GRCm39) intron probably benign
IGL02569:Fam227a APN 15 79,518,323 (GRCm39) missense probably benign
IGL02713:Fam227a APN 15 79,520,997 (GRCm39) splice site probably benign
IGL02734:Fam227a APN 15 79,502,042 (GRCm39) splice site probably benign
IGL02816:Fam227a APN 15 79,510,497 (GRCm39) missense possibly damaging 0.66
IGL03354:Fam227a APN 15 79,520,951 (GRCm39) missense possibly damaging 0.91
R0105:Fam227a UTSW 15 79,505,033 (GRCm39) missense possibly damaging 0.90
R0194:Fam227a UTSW 15 79,524,870 (GRCm39) nonsense probably null
R0437:Fam227a UTSW 15 79,528,189 (GRCm39) missense possibly damaging 0.90
R0786:Fam227a UTSW 15 79,510,469 (GRCm39) missense probably benign 0.01
R0925:Fam227a UTSW 15 79,505,006 (GRCm39) missense probably benign 0.04
R1200:Fam227a UTSW 15 79,496,738 (GRCm39) missense possibly damaging 0.66
R1424:Fam227a UTSW 15 79,518,309 (GRCm39) missense probably benign 0.34
R1474:Fam227a UTSW 15 79,499,582 (GRCm39) missense probably damaging 0.97
R1561:Fam227a UTSW 15 79,520,963 (GRCm39) missense possibly damaging 0.95
R1661:Fam227a UTSW 15 79,504,878 (GRCm39) splice site probably null
R1669:Fam227a UTSW 15 79,504,878 (GRCm39) splice site probably null
R1967:Fam227a UTSW 15 79,521,335 (GRCm39) missense possibly damaging 0.93
R1976:Fam227a UTSW 15 79,510,477 (GRCm39) missense possibly damaging 0.83
R2197:Fam227a UTSW 15 79,507,668 (GRCm39) missense probably damaging 0.97
R2230:Fam227a UTSW 15 79,499,582 (GRCm39) missense possibly damaging 0.66
R2231:Fam227a UTSW 15 79,499,582 (GRCm39) missense possibly damaging 0.66
R2232:Fam227a UTSW 15 79,499,582 (GRCm39) missense possibly damaging 0.66
R2910:Fam227a UTSW 15 79,520,935 (GRCm39) missense possibly damaging 0.81
R3027:Fam227a UTSW 15 79,532,934 (GRCm39) splice site probably null
R3943:Fam227a UTSW 15 79,505,060 (GRCm39) splice site probably benign
R4811:Fam227a UTSW 15 79,499,628 (GRCm39) missense possibly damaging 0.66
R4845:Fam227a UTSW 15 79,533,912 (GRCm39) missense probably damaging 0.99
R4896:Fam227a UTSW 15 79,521,255 (GRCm39) missense probably benign 0.32
R4934:Fam227a UTSW 15 79,521,262 (GRCm39) missense possibly damaging 0.71
R4941:Fam227a UTSW 15 79,524,204 (GRCm39) critical splice donor site probably null
R5225:Fam227a UTSW 15 79,520,936 (GRCm39) missense possibly damaging 0.90
R5369:Fam227a UTSW 15 79,499,637 (GRCm39) missense probably benign 0.27
R5593:Fam227a UTSW 15 79,524,259 (GRCm39) utr 3 prime probably benign
R6311:Fam227a UTSW 15 79,524,895 (GRCm39) missense probably benign 0.23
R6362:Fam227a UTSW 15 79,527,551 (GRCm39) missense possibly damaging 0.53
R6532:Fam227a UTSW 15 79,520,921 (GRCm39) missense probably benign 0.00
R7239:Fam227a UTSW 15 79,518,263 (GRCm39) critical splice donor site probably null
R7619:Fam227a UTSW 15 79,501,967 (GRCm39) missense probably benign
R7719:Fam227a UTSW 15 79,504,913 (GRCm39) missense possibly damaging 0.53
R8006:Fam227a UTSW 15 79,518,299 (GRCm39) missense possibly damaging 0.61
R8048:Fam227a UTSW 15 79,533,959 (GRCm39) start codon destroyed probably null
R8175:Fam227a UTSW 15 79,524,861 (GRCm39) missense probably damaging 0.97
R8439:Fam227a UTSW 15 79,514,271 (GRCm39) missense possibly damaging 0.53
R9014:Fam227a UTSW 15 79,504,958 (GRCm39) missense possibly damaging 0.96
R9034:Fam227a UTSW 15 79,532,952 (GRCm39) missense probably benign 0.00
R9582:Fam227a UTSW 15 79,501,978 (GRCm39) missense probably benign 0.33
R9613:Fam227a UTSW 15 79,518,284 (GRCm39) missense probably benign 0.09
R9668:Fam227a UTSW 15 79,526,444 (GRCm39) missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- ACAATGAGtgccgcagaccc -3'
(R):5'- GAGACCCACTGTAAACTCTGTCTTTTCC -3'

Sequencing Primer
(F):5'- ctgctaactggaatcttggaac -3'
(R):5'- TCCCTGGGCAAATACTCATATTCAC -3'
Posted On 2014-04-13