Incidental Mutation 'R1495:Krt75'
ID 168811
Institutional Source Beutler Lab
Gene Symbol Krt75
Ensembl Gene ENSMUSG00000022986
Gene Name keratin 75
Synonyms Krt2-6hf, Krtcap1, 4732468K03Rik, K6hf
MMRRC Submission 039546-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R1495 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 101471780-101482339 bp(-) (GRCm39)
Type of Mutation start gained
DNA Base Change (assembly) G to A at 101482308 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042957]
AlphaFold Q8BGZ7
Predicted Effect probably benign
Transcript: ENSMUST00000042957
SMART Domains Protein: ENSMUSP00000036246
Gene: ENSMUSG00000022986

DomainStartEndE-ValueType
Pfam:Keratin_2_head 16 146 1e-32 PFAM
Filament 149 462 1.68e-178 SMART
low complexity region 468 527 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196179
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type II keratin family clustered on the long arm of chromosome 12. Type I and type II keratins heteropolymerize to form intermediate-sized filaments in the cytoplasm of epithelial cells. This gene is expressed in the companion layer, upper germinative matrix region of the hair follicle, and medulla of the hair shaft. The encoded protein plays an essential role in hair and nail formation. Variations in this gene have been associated with the hair disorders pseudofolliculitis barbae (PFB) and loose anagen hair syndrome (LAHS). [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-in mutation that results in the deletion of the highly conserved asparagine residue (N159) in the helix initiation peptide of this gene develop hair shaft and nail abnormalities resembling pachyonychia congenita. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,614,356 (GRCm39) N488S probably benign Het
Acot10 G A 15: 20,665,593 (GRCm39) R383C probably damaging Het
Acsm2 A G 7: 119,177,349 (GRCm39) D263G probably damaging Het
Adcy2 G T 13: 68,944,654 (GRCm39) Q243K probably benign Het
Aggf1 G A 13: 95,492,921 (GRCm39) R563* probably null Het
Agt A G 8: 125,286,194 (GRCm39) F296S probably damaging Het
Akap14 T C X: 36,427,618 (GRCm39) D39G possibly damaging Het
Akt3 T C 1: 176,930,608 (GRCm39) M117V probably benign Het
Ankar T C 1: 72,682,450 (GRCm39) T1154A probably benign Het
Arvcf T A 16: 18,207,251 (GRCm39) L70Q probably damaging Het
Ccdc171 A T 4: 83,599,332 (GRCm39) K724* probably null Het
Ccdc91 A G 6: 147,435,670 (GRCm39) T85A possibly damaging Het
Ccdc9b T G 2: 118,591,013 (GRCm39) K173N probably damaging Het
Cdh3 C T 8: 107,265,629 (GRCm39) T224I probably damaging Het
Clstn3 T C 6: 124,426,876 (GRCm39) I482V probably benign Het
Cnot9 A G 1: 74,562,759 (GRCm39) E176G probably damaging Het
Cntnap4 T G 8: 113,608,395 (GRCm39) L1272V possibly damaging Het
Cyb5a T A 18: 84,869,605 (GRCm39) M1K probably null Het
Cyp2c23 A G 19: 43,993,947 (GRCm39) I473T probably benign Het
Dbil5 T A 11: 76,109,276 (GRCm39) M60K probably benign Het
Defa38 T A 8: 21,585,217 (GRCm39) Q75L probably benign Het
Dgkg A T 16: 22,319,129 (GRCm39) L644Q probably damaging Het
Disp3 T C 4: 148,334,282 (GRCm39) I1004V probably benign Het
Egf T A 3: 129,506,655 (GRCm39) I599F probably damaging Het
Epc2 A G 2: 49,426,675 (GRCm39) T145A probably damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,084,988 (GRCm39) probably benign Het
Extl3 A T 14: 65,313,316 (GRCm39) V622E probably benign Het
Fam227a C T 15: 79,510,446 (GRCm39) V403I probably benign Het
Fat2 T A 11: 55,153,499 (GRCm39) D3571V probably benign Het
Fcho2 A G 13: 98,886,358 (GRCm39) probably null Het
Fras1 A G 5: 96,676,445 (GRCm39) N64S possibly damaging Het
Gabbr1 A G 17: 37,366,832 (GRCm39) N352S possibly damaging Het
Gabra1 T C 11: 42,045,771 (GRCm39) N113S probably damaging Het
Glg1 T C 8: 111,924,307 (GRCm39) Y227C probably damaging Het
Gm5141 A T 13: 62,922,084 (GRCm39) C362S probably damaging Het
Gprc6a T A 10: 51,504,533 (GRCm39) T104S probably benign Het
Jph1 A C 1: 17,161,876 (GRCm39) V262G probably benign Het
Kank1 C G 19: 25,387,713 (GRCm39) T434R probably damaging Het
Kmt2e A G 5: 23,704,325 (GRCm39) S1173G possibly damaging Het
Lyzl1 G T 18: 4,181,192 (GRCm39) W77L probably null Het
Nipbl T G 15: 8,380,764 (GRCm39) N676T probably benign Het
Obscn C T 11: 58,970,986 (GRCm39) S2300N probably damaging Het
Or9a2 T G 6: 41,748,837 (GRCm39) Y132S probably damaging Het
Osbpl1a T A 18: 12,891,896 (GRCm39) M350L probably benign Het
Pecam1 T C 11: 106,579,682 (GRCm39) D460G probably damaging Het
Pik3c2a T A 7: 115,987,300 (GRCm39) K540N probably benign Het
Prdm12 T A 2: 31,530,205 (GRCm39) I32N probably damaging Het
Prkd1 T C 12: 50,413,135 (GRCm39) S679G probably damaging Het
Psen2 C T 1: 180,056,419 (GRCm39) A393T probably damaging Het
Ptprh T A 7: 4,583,888 (GRCm39) T235S probably benign Het
Ranbp3 C T 17: 57,012,527 (GRCm39) P182L probably benign Het
Serpinb7 A T 1: 107,379,390 (GRCm39) K266* probably null Het
Sesn3 T C 9: 14,219,817 (GRCm39) S69P probably damaging Het
Slc12a6 T C 2: 112,184,535 (GRCm39) M818T probably damaging Het
Slc25a53 C A X: 135,916,084 (GRCm39) C4F unknown Het
Snx1 T A 9: 66,003,879 (GRCm39) L255F probably benign Het
Sptbn2 T G 19: 4,769,004 (GRCm39) S46A possibly damaging Het
Taf4 A G 2: 179,574,820 (GRCm39) F595S probably damaging Het
Tec A T 5: 72,944,098 (GRCm39) V103E probably damaging Het
Tmco5b T C 2: 113,121,136 (GRCm39) S147P possibly damaging Het
Uchl5 C T 1: 143,675,675 (GRCm39) T93I possibly damaging Het
Usp14 A T 18: 10,004,994 (GRCm39) S225T probably benign Het
Usp45 C A 4: 21,797,385 (GRCm39) Q238K possibly damaging Het
Vmn1r6 T A 6: 56,980,058 (GRCm39) M218K possibly damaging Het
Zfp84 T A 7: 29,476,728 (GRCm39) Y473* probably null Het
Zyg11b G A 4: 108,123,410 (GRCm39) P186S probably damaging Het
Other mutations in Krt75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Krt75 APN 15 101,481,081 (GRCm39) missense probably benign
IGL01406:Krt75 APN 15 101,476,460 (GRCm39) missense probably damaging 1.00
IGL01783:Krt75 APN 15 101,473,364 (GRCm39) missense probably benign 0.01
IGL01911:Krt75 APN 15 101,476,537 (GRCm39) missense probably damaging 1.00
IGL01945:Krt75 APN 15 101,478,599 (GRCm39) missense possibly damaging 0.56
IGL02178:Krt75 APN 15 101,481,226 (GRCm39) missense probably benign 0.00
IGL02832:Krt75 APN 15 101,476,508 (GRCm39) missense probably benign 0.02
IGL03173:Krt75 APN 15 101,481,162 (GRCm39) missense probably damaging 1.00
IGL03276:Krt75 APN 15 101,476,811 (GRCm39) missense probably damaging 0.98
BB007:Krt75 UTSW 15 101,473,318 (GRCm39) makesense probably null
BB017:Krt75 UTSW 15 101,473,318 (GRCm39) makesense probably null
R0482:Krt75 UTSW 15 101,478,746 (GRCm39) missense probably benign 0.22
R0595:Krt75 UTSW 15 101,476,789 (GRCm39) missense probably damaging 1.00
R0626:Krt75 UTSW 15 101,482,025 (GRCm39) missense probably benign 0.05
R1886:Krt75 UTSW 15 101,479,532 (GRCm39) missense probably damaging 0.97
R1906:Krt75 UTSW 15 101,481,801 (GRCm39) missense possibly damaging 0.66
R1907:Krt75 UTSW 15 101,481,801 (GRCm39) missense possibly damaging 0.66
R2055:Krt75 UTSW 15 101,481,196 (GRCm39) missense probably benign 0.08
R2504:Krt75 UTSW 15 101,476,466 (GRCm39) missense probably benign 0.27
R2930:Krt75 UTSW 15 101,476,466 (GRCm39) missense probably benign 0.27
R3788:Krt75 UTSW 15 101,481,956 (GRCm39) missense possibly damaging 0.94
R4494:Krt75 UTSW 15 101,480,136 (GRCm39) nonsense probably null
R4803:Krt75 UTSW 15 101,476,507 (GRCm39) missense probably benign 0.00
R4868:Krt75 UTSW 15 101,476,556 (GRCm39) missense probably damaging 1.00
R4906:Krt75 UTSW 15 101,478,674 (GRCm39) missense probably damaging 1.00
R4969:Krt75 UTSW 15 101,482,248 (GRCm39) missense probably benign
R5069:Krt75 UTSW 15 101,474,673 (GRCm39) critical splice donor site probably null
R5446:Krt75 UTSW 15 101,479,502 (GRCm39) missense probably null 0.22
R6019:Krt75 UTSW 15 101,482,158 (GRCm39) missense probably benign 0.00
R6739:Krt75 UTSW 15 101,479,503 (GRCm39) missense probably benign 0.00
R6835:Krt75 UTSW 15 101,479,472 (GRCm39) missense probably benign 0.16
R7167:Krt75 UTSW 15 101,476,750 (GRCm39) missense possibly damaging 0.90
R7622:Krt75 UTSW 15 101,478,707 (GRCm39) missense probably damaging 1.00
R7930:Krt75 UTSW 15 101,473,318 (GRCm39) makesense probably null
R8046:Krt75 UTSW 15 101,481,199 (GRCm39) missense probably benign 0.01
R8943:Krt75 UTSW 15 101,476,767 (GRCm39) missense probably benign 0.03
R9360:Krt75 UTSW 15 101,476,729 (GRCm39) missense probably damaging 1.00
R9483:Krt75 UTSW 15 101,482,238 (GRCm39) missense probably benign 0.01
R9609:Krt75 UTSW 15 101,474,677 (GRCm39) missense probably benign 0.33
X0022:Krt75 UTSW 15 101,478,648 (GRCm39) missense possibly damaging 0.94
Z1088:Krt75 UTSW 15 101,482,100 (GRCm39) missense probably benign 0.00
Z1177:Krt75 UTSW 15 101,479,489 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAACTTCCTGAATGCCTCCAGAGGGAC -3'
(R):5'- TGCATGGTTAGGACATGACTGAAAGC -3'

Sequencing Primer
(F):5'- AAAGCCACTGCTAGTCCTG -3'
(R):5'- CTGGTCTGCTGATCAAGTTACAAC -3'
Posted On 2014-04-13