Mutagenetix > Incidental Mutation

Incidental Mutation 'R1495:Gabbr1'

168815

Institutional Source

Beutler Lab

Gene Symbol

Gabbr1

Ensembl Gene

ENSMUSG00000024462

Gene Name

gamma-aminobutyric acid (GABA) B receptor, 1

Synonyms

GABAB1, GABAbR1

MMRRC Submission

039546-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.685) question?

Stock #

R1495 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

37045966-37075067 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 37055940 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 352 (N352S)

Ref Sequence

ENSEMBL: ENSMUSP00000025338 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025338] [ENSMUST00000172792] [ENSMUST00000173823] [ENSMUST00000174347]

AlphaFold

Q9WV18

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025338
AA Change: N352S

PolyPhen 2 Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000025338
Gene: ENSMUSG00000024462
AA Change: N352S

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
CCP	29	95	8.72e0	SMART
CCP	99	156	3.03e-10	SMART
Pfam:Peripla_BP_6	168	538	1.6e-23	PFAM
Pfam:ANF_receptor	186	542	4.3e-73	PFAM
Pfam:7tm_3	602	858	9.8e-49	PFAM
coiled coil region	877	922	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172792
AA Change: N236S

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000134268
Gene: ENSMUSG00000024462
AA Change: N236S

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
low complexity region	30	51	N/A	INTRINSIC
Pfam:Peripla_BP_6	52	428	7.8e-24	PFAM
Pfam:ANF_receptor	70	426	5.7e-68	PFAM
Pfam:7tm_3	484	743	1.1e-50	PFAM
coiled coil region	761	806	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173564

Predicted Effect

probably benign
Transcript: ENSMUST00000173823

SMART Domains

Protein: ENSMUSP00000133797
Gene: ENSMUSG00000024462

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Sushi	29	95	1.6e-6	PFAM
low complexity region	159	176	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000174347
AA Change: N191S

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000134346
Gene: ENSMUSG00000024462
AA Change: N191S

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
low complexity region	30	51	N/A	INTRINSIC
Pfam:ANF_receptor	102	213	1e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174866

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.5%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for gamma-aminobutyric acid (GABA), which is the main inhibitory neurotransmitter in the mammalian central nervous system. This receptor functions as a heterodimer with GABA(B) receptor 2. Defects in this gene may underlie brain disorders such as schizophrenia and epilepsy. Alternative splicing generates multiple transcript variants, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jan 2016]
PHENOTYPE: Phenotypes of null mice vary depending on strain background and allele. Homozygous null mice may display seizures, premature death, and abnormal nervous system electrophysiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	A	G	13: 119,477,820	N488S	probably benign	Het
A430105I19Rik	T	G	2: 118,760,532	K173N	probably damaging	Het
Acot10	G	A	15: 20,665,507	R383C	probably damaging	Het
Acsm2	A	G	7: 119,578,126	D263G	probably damaging	Het
Adcy2	G	T	13: 68,796,535	Q243K	probably benign	Het
Aggf1	G	A	13: 95,356,413	R563*	probably null	Het
Agt	A	G	8: 124,559,455	F296S	probably damaging	Het
Akap14	T	C	X: 37,163,965	D39G	possibly damaging	Het
Akt3	T	C	1: 177,103,042	M117V	probably benign	Het
Ankar	T	C	1: 72,643,291	T1154A	probably benign	Het
Arvcf	T	A	16: 18,389,386	L70Q	probably damaging	Het
Ccdc171	A	T	4: 83,681,095	K724*	probably null	Het
Ccdc91	A	G	6: 147,534,172	T85A	possibly damaging	Het
Cdh3	C	T	8: 106,538,997	T224I	probably damaging	Het
Clstn3	T	C	6: 124,449,917	I482V	probably benign	Het
Cnot9	A	G	1: 74,523,600	E176G	probably damaging	Het
Cntnap4	T	G	8: 112,881,763	L1272V	possibly damaging	Het
Cyb5a	T	A	18: 84,851,480	M1K	probably null	Het
Cyp2c23	A	G	19: 44,005,508	I473T	probably benign	Het
Dbil5	T	A	11: 76,218,450	M60K	probably benign	Het
Dgkg	A	T	16: 22,500,379	L644Q	probably damaging	Het
Disp3	T	C	4: 148,249,825	I1004V	probably benign	Het
Egf	T	A	3: 129,713,006	I599F	probably damaging	Het
Epc2	A	G	2: 49,536,663	T145A	probably damaging	Het
Extl1	TGCGTTGCACCGATACCGGG	TG	4: 134,357,677		probably benign	Het
Extl3	A	T	14: 65,075,867	V622E	probably benign	Het
Fam227a	C	T	15: 79,626,245	V403I	probably benign	Het
Fat2	T	A	11: 55,262,673	D3571V	probably benign	Het
Fcho2	A	G	13: 98,749,850		probably null	Het
Fras1	A	G	5: 96,528,586	N64S	possibly damaging	Het
Gabra1	T	C	11: 42,154,944	N113S	probably damaging	Het
Glg1	T	C	8: 111,197,675	Y227C	probably damaging	Het
Gm14851	T	A	8: 21,095,201	Q75L	probably benign	Het
Gm5141	A	T	13: 62,774,270	C362S	probably damaging	Het
Gprc6a	T	A	10: 51,628,437	T104S	probably benign	Het
Jph1	A	C	1: 17,091,652	V262G	probably benign	Het
Kank1	C	G	19: 25,410,349	T434R	probably damaging	Het
Kmt2e	A	G	5: 23,499,327	S1173G	possibly damaging	Het
Krt75	G	A	15: 101,573,873		probably benign	Het
Lyzl1	G	T	18: 4,181,192	W77L	probably null	Het
Nipbl	T	G	15: 8,351,280	N676T	probably benign	Het
Obscn	C	T	11: 59,080,160	S2300N	probably damaging	Het
Olfr459	T	G	6: 41,771,903	Y132S	probably damaging	Het
Osbpl1a	T	A	18: 12,758,839	M350L	probably benign	Het
Pecam1	T	C	11: 106,688,856	D460G	probably damaging	Het
Pik3c2a	T	A	7: 116,388,065	K540N	probably benign	Het
Prdm12	T	A	2: 31,640,193	I32N	probably damaging	Het
Prkd1	T	C	12: 50,366,352	S679G	probably damaging	Het
Psen2	C	T	1: 180,228,854	A393T	probably damaging	Het
Ptprh	T	A	7: 4,580,889	T235S	probably benign	Het
Ranbp3	C	T	17: 56,705,527	P182L	probably benign	Het
Serpinb7	A	T	1: 107,451,660	K266*	probably null	Het
Sesn3	T	C	9: 14,308,521	S69P	probably damaging	Het
Slc12a6	T	C	2: 112,354,190	M818T	probably damaging	Het
Slc25a53	C	A	X: 137,015,335	C4F	unknown	Het
Snx1	T	A	9: 66,096,597	L255F	probably benign	Het
Sptbn2	T	G	19: 4,718,976	S46A	possibly damaging	Het
Taf4	A	G	2: 179,933,027	F595S	probably damaging	Het
Tec	A	T	5: 72,786,755	V103E	probably damaging	Het
Tmco5b	T	C	2: 113,290,791	S147P	possibly damaging	Het
Uchl5	C	T	1: 143,799,937	T93I	possibly damaging	Het
Usp14	A	T	18: 10,004,994	S225T	probably benign	Het
Usp45	C	A	4: 21,797,385	Q238K	possibly damaging	Het
Vmn1r6	T	A	6: 57,003,073	M218K	possibly damaging	Het
Zfp84	T	A	7: 29,777,303	Y473*	probably null	Het
Zyg11b	G	A	4: 108,266,213	P186S	probably damaging	Het

Other mutations in Gabbr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Gabbr1	APN	17	37048443	nonsense	probably null
IGL01309:Gabbr1	APN	17	37048607	critical splice donor site	probably null
IGL01413:Gabbr1	APN	17	37062706	missense	possibly damaging	0.93
IGL01568:Gabbr1	APN	17	37070669	missense	probably damaging	1.00
IGL01845:Gabbr1	APN	17	37048414	splice site	probably benign
IGL02083:Gabbr1	APN	17	37070065	missense	possibly damaging	0.84
IGL02302:Gabbr1	APN	17	37054797	missense	probably damaging	1.00
IGL02430:Gabbr1	APN	17	37056308	nonsense	probably null
IGL02533:Gabbr1	APN	17	37072147	missense	probably damaging	1.00
IGL02810:Gabbr1	APN	17	37062762	missense	probably damaging	1.00
H8562:Gabbr1	UTSW	17	37071949	missense	probably damaging	1.00
PIT4449001:Gabbr1	UTSW	17	37056350	missense	probably damaging	1.00
R0025:Gabbr1	UTSW	17	37067210	intron	probably benign
R0420:Gabbr1	UTSW	17	37046762	missense	possibly damaging	0.68
R0464:Gabbr1	UTSW	17	37050834	unclassified	probably benign
R1306:Gabbr1	UTSW	17	37055990	splice site	probably null
R1412:Gabbr1	UTSW	17	37054913	splice site	probably null
R1612:Gabbr1	UTSW	17	37070669	missense	probably damaging	1.00
R1658:Gabbr1	UTSW	17	37047507	missense	probably damaging	0.96
R1763:Gabbr1	UTSW	17	37054767	missense	probably damaging	1.00
R1779:Gabbr1	UTSW	17	37054879	missense	probably damaging	1.00
R1964:Gabbr1	UTSW	17	37048459	missense	probably damaging	1.00
R1996:Gabbr1	UTSW	17	37069220	missense	probably damaging	1.00
R2014:Gabbr1	UTSW	17	37056782	splice site	probably null
R2255:Gabbr1	UTSW	17	37071866	missense	probably damaging	1.00
R4299:Gabbr1	UTSW	17	37055900	nonsense	probably null
R4458:Gabbr1	UTSW	17	37067775	critical splice acceptor site	probably null
R4510:Gabbr1	UTSW	17	37069211	missense	probably damaging	1.00
R4511:Gabbr1	UTSW	17	37069211	missense	probably damaging	1.00
R4571:Gabbr1	UTSW	17	37054236	nonsense	probably null
R4597:Gabbr1	UTSW	17	37056899	missense	possibly damaging	0.74
R5109:Gabbr1	UTSW	17	37072028	intron	probably benign
R5119:Gabbr1	UTSW	17	37048438	missense	probably damaging	0.99
R5227:Gabbr1	UTSW	17	37070066	missense	possibly damaging	0.93
R5253:Gabbr1	UTSW	17	37055913	missense	possibly damaging	0.87
R5443:Gabbr1	UTSW	17	37070756	missense	probably damaging	1.00
R5485:Gabbr1	UTSW	17	37056875	missense	possibly damaging	0.83
R5839:Gabbr1	UTSW	17	37067868	missense	probably damaging	1.00
R5976:Gabbr1	UTSW	17	37067862	missense	probably damaging	1.00
R6156:Gabbr1	UTSW	17	37048427	missense	probably benign	0.01
R6167:Gabbr1	UTSW	17	37063379	missense	probably damaging	1.00
R6214:Gabbr1	UTSW	17	37069365	missense	probably damaging	1.00
R6215:Gabbr1	UTSW	17	37069365	missense	probably damaging	1.00
R6348:Gabbr1	UTSW	17	37056899	missense	possibly damaging	0.94
R6721:Gabbr1	UTSW	17	37054192	missense	probably damaging	0.98
R7028:Gabbr1	UTSW	17	37064737	nonsense	probably null
R7317:Gabbr1	UTSW	17	37069413	missense	probably damaging	1.00
R7786:Gabbr1	UTSW	17	37070063	missense	probably damaging	0.98
R7793:Gabbr1	UTSW	17	37047501	missense	probably benign	0.13
R7833:Gabbr1	UTSW	17	37056969	missense	possibly damaging	0.88
R8110:Gabbr1	UTSW	17	37048583	missense	probably benign	0.10
R8318:Gabbr1	UTSW	17	37062543	missense	probably benign	0.23
R8774:Gabbr1	UTSW	17	37071857	missense	probably damaging	1.00
R8774-TAIL:Gabbr1	UTSW	17	37071857	missense	probably damaging	1.00
R8890:Gabbr1	UTSW	17	37047544	missense	probably benign	0.02
R9144:Gabbr1	UTSW	17	37051157	missense	probably benign
R9292:Gabbr1	UTSW	17	37055892	missense	possibly damaging	0.94
R9359:Gabbr1	UTSW	17	37070713	missense	probably damaging	1.00
X0010:Gabbr1	UTSW	17	37070780	missense	probably damaging	0.99
Z1177:Gabbr1	UTSW	17	37048424	missense	possibly damaging	0.57

Predicted Primers

PCR Primer
(F):5'- ATGCATCTTGGAAGCTGCCTCC -3'
(R):5'- TGAGCCGTCTCACAGAATGAACAAC -3'

Sequencing Primer
(F):5'- TTGGAAGCTGCCTCCTAAGAC -3'
(R):5'- TGAACAACTGCCTCTTCCAGG -3'

Posted On

2014-04-13