Incidental Mutation 'R1495:Osbpl1a'
ID 168819
Institutional Source Beutler Lab
Gene Symbol Osbpl1a
Ensembl Gene ENSMUSG00000044252
Gene Name oxysterol binding protein-like 1A
Synonyms G430090F17Rik, LOC328902
MMRRC Submission 039546-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R1495 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 12888371-13074898 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 12891896 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 350 (M350L)
Ref Sequence ENSEMBL: ENSMUSP00000112895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074352] [ENSMUST00000080415] [ENSMUST00000115857] [ENSMUST00000117361] [ENSMUST00000118313] [ENSMUST00000119043] [ENSMUST00000119512] [ENSMUST00000121774] [ENSMUST00000121888] [ENSMUST00000121808] [ENSMUST00000191078] [ENSMUST00000150758] [ENSMUST00000186263] [ENSMUST00000121018] [ENSMUST00000119108]
AlphaFold Q91XL9
Predicted Effect probably benign
Transcript: ENSMUST00000074352
AA Change: M863L

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000073957
Gene: ENSMUSG00000044252
AA Change: M863L

DomainStartEndE-ValueType
ANK 47 76 2.05e-6 SMART
ANK 80 109 1.29e-3 SMART
low complexity region 141 153 N/A INTRINSIC
ANK 175 204 1.31e-4 SMART
PH 236 336 6.02e-8 SMART
low complexity region 345 354 N/A INTRINSIC
coiled coil region 430 463 N/A INTRINSIC
Pfam:Oxysterol_BP 548 940 6.7e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080415
SMART Domains Protein: ENSMUSP00000079277
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115857
SMART Domains Protein: ENSMUSP00000111523
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.2e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117361
AA Change: M350L

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000112681
Gene: ENSMUSG00000044252
AA Change: M350L

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118313
AA Change: M350L

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113735
Gene: ENSMUSG00000044252
AA Change: M350L

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119043
AA Change: M350L

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113357
Gene: ENSMUSG00000044252
AA Change: M350L

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119512
AA Change: M471L

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113914
Gene: ENSMUSG00000044252
AA Change: M471L

DomainStartEndE-ValueType
coiled coil region 38 71 N/A INTRINSIC
Pfam:Oxysterol_BP 156 549 1.2e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121774
AA Change: M323L

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113268
Gene: ENSMUSG00000044252
AA Change: M323L

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 8 401 4e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121888
AA Change: M350L

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000112895
Gene: ENSMUSG00000044252
AA Change: M350L

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121808
AA Change: M350L

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113841
Gene: ENSMUSG00000044252
AA Change: M350L

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145777
Predicted Effect probably benign
Transcript: ENSMUST00000191078
SMART Domains Protein: ENSMUSP00000140894
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150758
SMART Domains Protein: ENSMUSP00000118330
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186263
SMART Domains Protein: ENSMUSP00000140870
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121018
SMART Domains Protein: ENSMUSP00000113131
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 6.7e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119108
SMART Domains Protein: ENSMUSP00000113760
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 8.5e-13 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain, although some members contain only the sterol-binding domain. Transcript variants derived from alternative promoter usage and/or alternative splicing exist; they encode different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,614,356 (GRCm39) N488S probably benign Het
Acot10 G A 15: 20,665,593 (GRCm39) R383C probably damaging Het
Acsm2 A G 7: 119,177,349 (GRCm39) D263G probably damaging Het
Adcy2 G T 13: 68,944,654 (GRCm39) Q243K probably benign Het
Aggf1 G A 13: 95,492,921 (GRCm39) R563* probably null Het
Agt A G 8: 125,286,194 (GRCm39) F296S probably damaging Het
Akap14 T C X: 36,427,618 (GRCm39) D39G possibly damaging Het
Akt3 T C 1: 176,930,608 (GRCm39) M117V probably benign Het
Ankar T C 1: 72,682,450 (GRCm39) T1154A probably benign Het
Arvcf T A 16: 18,207,251 (GRCm39) L70Q probably damaging Het
Ccdc171 A T 4: 83,599,332 (GRCm39) K724* probably null Het
Ccdc91 A G 6: 147,435,670 (GRCm39) T85A possibly damaging Het
Ccdc9b T G 2: 118,591,013 (GRCm39) K173N probably damaging Het
Cdh3 C T 8: 107,265,629 (GRCm39) T224I probably damaging Het
Clstn3 T C 6: 124,426,876 (GRCm39) I482V probably benign Het
Cnot9 A G 1: 74,562,759 (GRCm39) E176G probably damaging Het
Cntnap4 T G 8: 113,608,395 (GRCm39) L1272V possibly damaging Het
Cyb5a T A 18: 84,869,605 (GRCm39) M1K probably null Het
Cyp2c23 A G 19: 43,993,947 (GRCm39) I473T probably benign Het
Dbil5 T A 11: 76,109,276 (GRCm39) M60K probably benign Het
Defa38 T A 8: 21,585,217 (GRCm39) Q75L probably benign Het
Dgkg A T 16: 22,319,129 (GRCm39) L644Q probably damaging Het
Disp3 T C 4: 148,334,282 (GRCm39) I1004V probably benign Het
Egf T A 3: 129,506,655 (GRCm39) I599F probably damaging Het
Epc2 A G 2: 49,426,675 (GRCm39) T145A probably damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,084,988 (GRCm39) probably benign Het
Extl3 A T 14: 65,313,316 (GRCm39) V622E probably benign Het
Fam227a C T 15: 79,510,446 (GRCm39) V403I probably benign Het
Fat2 T A 11: 55,153,499 (GRCm39) D3571V probably benign Het
Fcho2 A G 13: 98,886,358 (GRCm39) probably null Het
Fras1 A G 5: 96,676,445 (GRCm39) N64S possibly damaging Het
Gabbr1 A G 17: 37,366,832 (GRCm39) N352S possibly damaging Het
Gabra1 T C 11: 42,045,771 (GRCm39) N113S probably damaging Het
Glg1 T C 8: 111,924,307 (GRCm39) Y227C probably damaging Het
Gm5141 A T 13: 62,922,084 (GRCm39) C362S probably damaging Het
Gprc6a T A 10: 51,504,533 (GRCm39) T104S probably benign Het
Jph1 A C 1: 17,161,876 (GRCm39) V262G probably benign Het
Kank1 C G 19: 25,387,713 (GRCm39) T434R probably damaging Het
Kmt2e A G 5: 23,704,325 (GRCm39) S1173G possibly damaging Het
Krt75 G A 15: 101,482,308 (GRCm39) probably benign Het
Lyzl1 G T 18: 4,181,192 (GRCm39) W77L probably null Het
Nipbl T G 15: 8,380,764 (GRCm39) N676T probably benign Het
Obscn C T 11: 58,970,986 (GRCm39) S2300N probably damaging Het
Or9a2 T G 6: 41,748,837 (GRCm39) Y132S probably damaging Het
Pecam1 T C 11: 106,579,682 (GRCm39) D460G probably damaging Het
Pik3c2a T A 7: 115,987,300 (GRCm39) K540N probably benign Het
Prdm12 T A 2: 31,530,205 (GRCm39) I32N probably damaging Het
Prkd1 T C 12: 50,413,135 (GRCm39) S679G probably damaging Het
Psen2 C T 1: 180,056,419 (GRCm39) A393T probably damaging Het
Ptprh T A 7: 4,583,888 (GRCm39) T235S probably benign Het
Ranbp3 C T 17: 57,012,527 (GRCm39) P182L probably benign Het
Serpinb7 A T 1: 107,379,390 (GRCm39) K266* probably null Het
Sesn3 T C 9: 14,219,817 (GRCm39) S69P probably damaging Het
Slc12a6 T C 2: 112,184,535 (GRCm39) M818T probably damaging Het
Slc25a53 C A X: 135,916,084 (GRCm39) C4F unknown Het
Snx1 T A 9: 66,003,879 (GRCm39) L255F probably benign Het
Sptbn2 T G 19: 4,769,004 (GRCm39) S46A possibly damaging Het
Taf4 A G 2: 179,574,820 (GRCm39) F595S probably damaging Het
Tec A T 5: 72,944,098 (GRCm39) V103E probably damaging Het
Tmco5b T C 2: 113,121,136 (GRCm39) S147P possibly damaging Het
Uchl5 C T 1: 143,675,675 (GRCm39) T93I possibly damaging Het
Usp14 A T 18: 10,004,994 (GRCm39) S225T probably benign Het
Usp45 C A 4: 21,797,385 (GRCm39) Q238K possibly damaging Het
Vmn1r6 T A 6: 56,980,058 (GRCm39) M218K possibly damaging Het
Zfp84 T A 7: 29,476,728 (GRCm39) Y473* probably null Het
Zyg11b G A 4: 108,123,410 (GRCm39) P186S probably damaging Het
Other mutations in Osbpl1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Osbpl1a APN 18 12,890,683 (GRCm39) missense possibly damaging 0.51
IGL01062:Osbpl1a APN 18 13,038,132 (GRCm39) missense probably benign
IGL01450:Osbpl1a APN 18 13,004,152 (GRCm39) missense possibly damaging 0.88
IGL01531:Osbpl1a APN 18 13,066,638 (GRCm39) missense probably damaging 1.00
IGL01548:Osbpl1a APN 18 12,896,632 (GRCm39) missense probably damaging 1.00
IGL01606:Osbpl1a APN 18 12,889,271 (GRCm39) missense possibly damaging 0.79
IGL01672:Osbpl1a APN 18 12,899,881 (GRCm39) missense probably damaging 1.00
IGL02372:Osbpl1a APN 18 12,974,370 (GRCm39) nonsense probably null
IGL02451:Osbpl1a APN 18 13,047,550 (GRCm39) splice site probably benign
IGL02490:Osbpl1a APN 18 13,015,341 (GRCm39) unclassified probably benign
IGL02884:Osbpl1a APN 18 12,952,635 (GRCm39) nonsense probably null
R0084:Osbpl1a UTSW 18 12,890,669 (GRCm39) missense probably benign 0.07
R0266:Osbpl1a UTSW 18 13,004,220 (GRCm39) splice site probably null
R0565:Osbpl1a UTSW 18 12,892,501 (GRCm39) missense probably damaging 1.00
R0605:Osbpl1a UTSW 18 13,015,336 (GRCm39) critical splice acceptor site probably null
R0899:Osbpl1a UTSW 18 12,890,747 (GRCm39) missense possibly damaging 0.70
R1330:Osbpl1a UTSW 18 13,015,251 (GRCm39) critical splice donor site probably null
R1464:Osbpl1a UTSW 18 13,047,615 (GRCm39) missense probably benign
R1464:Osbpl1a UTSW 18 13,047,615 (GRCm39) missense probably benign
R1475:Osbpl1a UTSW 18 12,890,737 (GRCm39) missense probably damaging 1.00
R1734:Osbpl1a UTSW 18 12,921,373 (GRCm39) splice site probably null
R1930:Osbpl1a UTSW 18 13,038,251 (GRCm39) missense probably benign 0.04
R1931:Osbpl1a UTSW 18 13,038,251 (GRCm39) missense probably benign 0.04
R2109:Osbpl1a UTSW 18 12,892,457 (GRCm39) missense probably damaging 1.00
R2144:Osbpl1a UTSW 18 13,004,230 (GRCm39) missense probably benign 0.06
R2504:Osbpl1a UTSW 18 13,038,088 (GRCm39) missense probably benign 0.30
R2762:Osbpl1a UTSW 18 12,899,956 (GRCm39) missense possibly damaging 0.83
R2907:Osbpl1a UTSW 18 13,004,129 (GRCm39) unclassified probably benign
R4306:Osbpl1a UTSW 18 12,952,652 (GRCm39) missense probably benign
R4835:Osbpl1a UTSW 18 12,901,593 (GRCm39) critical splice donor site probably null
R5097:Osbpl1a UTSW 18 12,896,594 (GRCm39) missense probably damaging 1.00
R5173:Osbpl1a UTSW 18 12,895,697 (GRCm39) missense probably benign 0.12
R5224:Osbpl1a UTSW 18 13,066,753 (GRCm39) missense probably benign 0.01
R5245:Osbpl1a UTSW 18 12,891,910 (GRCm39) missense probably damaging 1.00
R5579:Osbpl1a UTSW 18 13,025,319 (GRCm39) missense probably benign 0.22
R5579:Osbpl1a UTSW 18 12,974,249 (GRCm39) missense probably damaging 1.00
R5833:Osbpl1a UTSW 18 12,921,419 (GRCm39) missense probably damaging 1.00
R5986:Osbpl1a UTSW 18 13,038,138 (GRCm39) missense probably damaging 1.00
R6267:Osbpl1a UTSW 18 12,952,560 (GRCm39) critical splice donor site probably null
R6296:Osbpl1a UTSW 18 12,952,560 (GRCm39) critical splice donor site probably null
R6477:Osbpl1a UTSW 18 12,889,318 (GRCm39) missense probably benign 0.03
R6997:Osbpl1a UTSW 18 12,889,281 (GRCm39) missense probably benign 0.05
R7105:Osbpl1a UTSW 18 12,900,020 (GRCm39) missense probably benign 0.17
R7107:Osbpl1a UTSW 18 12,974,310 (GRCm39) nonsense probably null
R7154:Osbpl1a UTSW 18 12,901,649 (GRCm39) missense probably benign 0.00
R7459:Osbpl1a UTSW 18 13,066,642 (GRCm39) missense probably damaging 1.00
R7757:Osbpl1a UTSW 18 13,066,657 (GRCm39) missense probably benign 0.44
R7797:Osbpl1a UTSW 18 13,015,321 (GRCm39) missense probably damaging 0.99
R8029:Osbpl1a UTSW 18 13,047,578 (GRCm39) missense probably benign 0.01
R8084:Osbpl1a UTSW 18 13,038,099 (GRCm39) missense probably damaging 1.00
R8506:Osbpl1a UTSW 18 12,901,643 (GRCm39) missense probably benign 0.02
R8947:Osbpl1a UTSW 18 12,899,858 (GRCm39) critical splice donor site probably null
R9069:Osbpl1a UTSW 18 13,002,074 (GRCm39) intron probably benign
R9085:Osbpl1a UTSW 18 13,062,093 (GRCm39) missense probably damaging 1.00
R9288:Osbpl1a UTSW 18 12,904,402 (GRCm39) missense probably damaging 1.00
R9443:Osbpl1a UTSW 18 13,031,244 (GRCm39) missense probably benign 0.00
R9517:Osbpl1a UTSW 18 13,042,965 (GRCm39) missense probably benign
R9600:Osbpl1a UTSW 18 13,015,277 (GRCm39) missense probably benign 0.00
R9658:Osbpl1a UTSW 18 12,889,269 (GRCm39) missense probably benign 0.05
R9694:Osbpl1a UTSW 18 12,952,565 (GRCm39) missense probably benign 0.03
X0027:Osbpl1a UTSW 18 12,892,560 (GRCm39) missense possibly damaging 0.46
Z1177:Osbpl1a UTSW 18 13,039,980 (GRCm39) missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTTCCAAACGTAAAGCCAAAGGTGC -3'
(R):5'- AGGGGTGAGACAAGCCCTTGTTAG -3'

Sequencing Primer
(F):5'- GCCAAAGGTGCTAGATTTTAACAG -3'
(R):5'- GCCCTTGTTAGACAAACTGATGC -3'
Posted On 2014-04-13