Incidental Mutation 'R1496:Tnni3k'
ID168849
Institutional Source Beutler Lab
Gene Symbol Tnni3k
Ensembl Gene ENSMUSG00000040086
Gene NameTNNI3 interacting kinase
SynonymsCark, D830019J24Rik
MMRRC Submission 039547-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R1496 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location154786291-155055407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 154939658 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 530 (D530G)
Ref Sequence ENSEMBL: ENSMUSP00000122478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064076] [ENSMUST00000143410]
Predicted Effect probably damaging
Transcript: ENSMUST00000064076
AA Change: D530G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070561
Gene: ENSMUSG00000040086
AA Change: D530G

DomainStartEndE-ValueType
coiled coil region 21 49 N/A INTRINSIC
ANK 66 96 9.46e1 SMART
ANK 100 129 4.43e-2 SMART
ANK 133 162 3.15e-7 SMART
ANK 166 195 6.12e-5 SMART
ANK 199 229 1.65e-1 SMART
ANK 233 264 6.07e0 SMART
ANK 268 299 8.99e-3 SMART
ANK 303 334 1.19e-2 SMART
ANK 338 367 7.76e-7 SMART
ANK 380 409 2.43e1 SMART
Pfam:Pkinase 462 718 6.7e-48 PFAM
Pfam:Pkinase_Tyr 462 718 2.1e-59 PFAM
low complexity region 727 750 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000143410
AA Change: D530G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122478
Gene: ENSMUSG00000040086
AA Change: D530G

DomainStartEndE-ValueType
coiled coil region 21 49 N/A INTRINSIC
ANK 66 96 9.46e1 SMART
ANK 100 129 4.43e-2 SMART
ANK 133 162 3.15e-7 SMART
ANK 166 195 6.12e-5 SMART
ANK 199 229 1.65e-1 SMART
ANK 233 264 6.07e0 SMART
ANK 268 299 8.99e-3 SMART
ANK 303 334 1.19e-2 SMART
ANK 338 367 7.76e-7 SMART
ANK 380 409 2.43e1 SMART
Pfam:Pkinase 462 674 3.5e-48 PFAM
Pfam:Pkinase_Tyr 462 674 3.6e-52 PFAM
Meta Mutation Damage Score 0.1293 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.9%
Validation Efficiency 98% (94/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the MAP kinase kinase kinase (MAPKKK) family of protein kinases. The protein contains ankyrin repeat, protein kinase and serine-rich domains and is thought to play a role in cardiac physiology. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a conditional allele activated in cardiac myocytes exhibit decreased response to cardiac ischemic/reperfusion injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A G 9: 46,310,254 probably benign Het
4933411K16Rik T C 19: 42,053,050 Y207H probably damaging Het
Abcc1 T A 16: 14,448,434 L832Q probably damaging Het
Acan T A 7: 79,100,804 H1774Q probably benign Het
Adss T C 1: 177,772,194 T275A probably benign Het
Ano5 G A 7: 51,583,775 R595H probably damaging Het
Araf G T X: 20,859,704 R522L probably damaging Het
Arhgef28 C T 13: 97,965,546 V807I possibly damaging Het
Bin1 T C 18: 32,412,704 I103T probably damaging Het
C4b C T 17: 34,740,021 R478Q probably benign Het
Cacna1b G A 2: 24,678,035 P1015S probably benign Het
Capn1 A G 19: 6,007,498 probably null Het
Cep290 A G 10: 100,538,966 Q1358R probably damaging Het
Cfap126 T C 1: 171,125,817 probably benign Het
Chn1 T C 2: 73,679,607 probably benign Het
Cldn8 T C 16: 88,562,401 E212G probably benign Het
Cpb1 T C 3: 20,263,532 N249S probably damaging Het
Cxcr6 A T 9: 123,810,347 I138F probably benign Het
Dab2ip G A 2: 35,718,791 R579H probably damaging Het
Dcaf8 T C 1: 172,193,855 M538T probably benign Het
Dhrs4 T G 14: 55,487,650 L201V probably damaging Het
Dnah12 C T 14: 26,710,248 A407V probably benign Het
Elavl3 T A 9: 22,026,165 probably benign Het
Elp4 T C 2: 105,832,161 H88R probably benign Het
Ercc3 T C 18: 32,261,297 probably benign Het
Eri1 A G 8: 35,469,181 S329P possibly damaging Het
Erich2 A T 2: 70,512,773 probably benign Het
Esyt1 A G 10: 128,512,428 S864P possibly damaging Het
Fam170b A G 14: 32,835,631 E141G probably damaging Het
Fat1 A G 8: 45,033,390 Y3304C probably damaging Het
Fbn1 T C 2: 125,309,495 T2531A probably benign Het
Fgfr3 T C 5: 33,729,750 V166A probably damaging Het
Glt8d2 T C 10: 82,659,538 D194G probably damaging Het
Gpr89 A G 3: 96,905,210 I5T probably benign Het
Gpx6 A T 13: 21,318,920 H168L probably benign Het
Gusb T C 5: 129,998,544 T307A probably benign Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Ifngr1 A G 10: 19,601,445 D118G probably benign Het
Ipcef1 A T 10: 6,935,173 probably null Het
Kbtbd3 A T 9: 4,330,276 T217S probably benign Het
Kmt5a GAA GA 5: 124,459,885 probably null Het
Lrp1 T C 10: 127,539,011 D4526G probably damaging Het
Lrp1b A T 2: 42,323,662 V46D probably damaging Het
Lsm8 T A 6: 18,849,659 M22K probably benign Het
Map1lc3b C T 8: 121,596,600 R70C possibly damaging Het
Meiob T A 17: 24,813,052 S14T possibly damaging Het
Mkx G T 18: 6,992,330 Y183* probably null Het
Mrs2 T C 13: 25,005,034 Y99C probably benign Het
Mycbpap T C 11: 94,505,561 K151R probably benign Het
Neb T G 2: 52,328,734 Q88P probably damaging Het
Noc4l T A 5: 110,650,078 H319L probably damaging Het
Nt5c2 G A 19: 46,904,978 T122I probably damaging Het
Nuggc A T 14: 65,624,133 N476I probably damaging Het
Obscn T A 11: 59,031,036 H5978L probably benign Het
Oc90 G T 15: 65,876,521 A412D probably damaging Het
Olfr1080 A T 2: 86,553,752 V124E probably damaging Het
Olfr1143 T G 2: 87,802,868 S160A probably benign Het
Olfr1249 A G 2: 89,630,014 S295P possibly damaging Het
Olfr168 T A 16: 19,530,383 D179V possibly damaging Het
Olfr399 A G 11: 74,053,824 *312Q probably null Het
Olfr8 T A 10: 78,955,848 S214R probably benign Het
Pdzrn3 A T 6: 101,150,969 V912E probably benign Het
Phactr1 T A 13: 43,094,990 Y387N probably damaging Het
Picalm T A 7: 90,130,651 C27S probably benign Het
Pkd1l1 T A 11: 8,941,077 I314F possibly damaging Het
Pold2 T C 11: 5,874,175 E210G possibly damaging Het
Ptprz1 C T 6: 23,049,524 probably benign Het
Rac1 G T 5: 143,507,338 A165E probably damaging Het
Rpap3 G T 15: 97,686,483 T360K possibly damaging Het
Scn9a G A 2: 66,526,888 T1012I probably benign Het
Sdad1 A G 5: 92,309,823 I20T possibly damaging Het
Setbp1 T G 18: 78,859,912 K180T probably damaging Het
Sgpl1 T C 10: 61,102,589 N475S probably damaging Het
Shroom3 T C 5: 92,942,834 S1148P possibly damaging Het
Sin3a T A 9: 57,119,158 H1119Q possibly damaging Het
Slc26a7 T A 4: 14,506,489 Y620F probably benign Het
Slc4a1 T C 11: 102,361,171 I36V probably benign Het
Smarca2 C G 19: 26,631,101 P263A possibly damaging Het
Sp100 T C 1: 85,663,521 probably benign Het
Spag6l A G 16: 16,780,614 probably benign Het
Sptbn1 T C 11: 30,121,498 N1491S probably damaging Het
Tbl1xr1 T G 3: 22,190,951 V155G possibly damaging Het
Tmc1 A G 19: 20,868,355 I168T probably damaging Het
Tmem87b G A 2: 128,826,393 probably null Het
Tnfrsf9 T A 4: 150,933,104 probably null Het
Vmn1r209 G A 13: 22,805,764 S252F probably damaging Het
Zbtb3 A T 19: 8,803,350 N109I probably damaging Het
Zdhhc17 T G 10: 110,946,210 H541P probably damaging Het
Zfp84 A G 7: 29,776,614 I244V possibly damaging Het
Zyx A G 6: 42,356,312 Y393C probably damaging Het
Other mutations in Tnni3k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Tnni3k APN 3 155054555 missense probably benign 0.00
IGL00852:Tnni3k APN 3 155054569 missense probably benign 0.00
IGL01090:Tnni3k APN 3 154939683 missense possibly damaging 0.69
IGL01593:Tnni3k APN 3 154941029 splice site probably null
IGL01724:Tnni3k APN 3 154939626 missense possibly damaging 0.53
IGL01887:Tnni3k APN 3 154875187 splice site probably null
IGL01992:Tnni3k APN 3 154962026 missense probably damaging 0.99
IGL02945:Tnni3k APN 3 155037438 missense possibly damaging 0.48
IGL02990:Tnni3k APN 3 154957758 missense probably benign 0.01
IGL03069:Tnni3k APN 3 154941605 splice site probably null
IGL03325:Tnni3k APN 3 154961814 missense probably damaging 1.00
IGL03405:Tnni3k APN 3 154792767 splice site probably benign
R0211:Tnni3k UTSW 3 155055344 start gained probably benign
R0682:Tnni3k UTSW 3 154940028 missense probably damaging 1.00
R0693:Tnni3k UTSW 3 154961972 missense probably damaging 1.00
R0907:Tnni3k UTSW 3 154941679 missense probably damaging 1.00
R1109:Tnni3k UTSW 3 154792777 missense possibly damaging 0.83
R1180:Tnni3k UTSW 3 154875513 missense probably damaging 1.00
R1181:Tnni3k UTSW 3 154875513 missense probably damaging 1.00
R1476:Tnni3k UTSW 3 155030305 missense probably benign 0.05
R1687:Tnni3k UTSW 3 154939626 missense possibly damaging 0.53
R1704:Tnni3k UTSW 3 154827508 missense probably benign 0.27
R1913:Tnni3k UTSW 3 154979199 missense probably benign 0.00
R2343:Tnni3k UTSW 3 154938829 missense probably benign 0.00
R2374:Tnni3k UTSW 3 154786785 missense probably benign 0.12
R2869:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R2869:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R2871:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R2871:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R2872:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R2872:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R2873:Tnni3k UTSW 3 154938750 critical splice donor site probably null
R4858:Tnni3k UTSW 3 154786808 splice site probably null
R5597:Tnni3k UTSW 3 154872128 missense probably damaging 1.00
R5806:Tnni3k UTSW 3 154827611 missense possibly damaging 0.88
R5871:Tnni3k UTSW 3 155030370 missense probably benign 0.23
R6467:Tnni3k UTSW 3 154969285 missense probably damaging 0.97
R6475:Tnni3k UTSW 3 154941058 nonsense probably null
R6882:Tnni3k UTSW 3 154957720 missense possibly damaging 0.49
R6976:Tnni3k UTSW 3 154792776 missense probably benign 0.14
R6986:Tnni3k UTSW 3 154961864 missense probably damaging 1.00
R7207:Tnni3k UTSW 3 154875145 missense probably damaging 1.00
R7539:Tnni3k UTSW 3 154962031 missense probably benign 0.01
R7843:Tnni3k UTSW 3 155038524 missense probably damaging 0.98
R7926:Tnni3k UTSW 3 155038524 missense probably damaging 0.98
Z1088:Tnni3k UTSW 3 154939670 missense probably damaging 1.00
Z1176:Tnni3k UTSW 3 155038557 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAAACCACCCCATAGTTGCTGTCC -3'
(R):5'- ATTGACATGAATGTGTCCCCACTCC -3'

Sequencing Primer
(F):5'- TGCTGTCCGCAGAGATCTAAG -3'
(R):5'- ACTCCTGTCCTAGATACCGAG -3'
Posted On2014-04-13