Incidental Mutation 'R1496:Gusb'
ID168856
Institutional Source Beutler Lab
Gene Symbol Gusb
Ensembl Gene ENSMUSG00000025534
Gene Nameglucuronidase, beta
SynonymsGut, Gus, asd, Gur, g, Gus-s, Gus-r, adipose storage deficiency, Gus-u, Gus-t
MMRRC Submission 039547-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R1496 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location129989011-130003049 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129998544 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 307 (T307A)
Ref Sequence ENSEMBL: ENSMUSP00000026613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026613] [ENSMUST00000111307] [ENSMUST00000111308] [ENSMUST00000201801]
Predicted Effect probably benign
Transcript: ENSMUST00000026613
AA Change: T307A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000026613
Gene: ENSMUSG00000025534
AA Change: T307A

DomainStartEndE-ValueType
Pfam:Glyco_hydro_2_N 35 223 4e-46 PFAM
Pfam:Glyco_hydro_2 225 323 6.4e-12 PFAM
Pfam:Glyco_hydro_2_C 325 627 9e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111307
SMART Domains Protein: ENSMUSP00000106939
Gene: ENSMUSG00000025534

DomainStartEndE-ValueType
Pfam:Glyco_hydro_2_N 35 143 2.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111308
SMART Domains Protein: ENSMUSP00000106940
Gene: ENSMUSG00000025534

DomainStartEndE-ValueType
Pfam:Glyco_hydro_2_N 35 223 7.7e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122994
Predicted Effect probably benign
Transcript: ENSMUST00000201801
SMART Domains Protein: ENSMUSP00000144478
Gene: ENSMUSG00000025534

DomainStartEndE-ValueType
Pfam:Glyco_hydro_2_N 35 138 5.5e-19 PFAM
Meta Mutation Damage Score 0.0609 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.9%
Validation Efficiency 98% (94/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hydrolase that degrades glycosaminoglycans, including heparan sulfate, dermatan sulfate, and chondroitin-4,6-sulfate. The enzyme forms a homotetramer that is localized to the lysosome. Mutations in this gene result in mucopolysaccharidosis type VII. Alternative splicing results in multiple transcript variants. There are many pseudogenes of this locus in the human genome.[provided by RefSeq, May 2014]
PHENOTYPE: Knock-in mutations of this gene lead to lysosomal storage disease and may cause premature death, facial, tail and limb anomalies, growth retardation, male sterility, reduced lactation, osteosclerosis and behavioral defects. Additional phenotypes include partial neonatal death and deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A G 9: 46,310,254 probably benign Het
4933411K16Rik T C 19: 42,053,050 Y207H probably damaging Het
Abcc1 T A 16: 14,448,434 L832Q probably damaging Het
Acan T A 7: 79,100,804 H1774Q probably benign Het
Adss T C 1: 177,772,194 T275A probably benign Het
Ano5 G A 7: 51,583,775 R595H probably damaging Het
Araf G T X: 20,859,704 R522L probably damaging Het
Arhgef28 C T 13: 97,965,546 V807I possibly damaging Het
Bin1 T C 18: 32,412,704 I103T probably damaging Het
C4b C T 17: 34,740,021 R478Q probably benign Het
Cacna1b G A 2: 24,678,035 P1015S probably benign Het
Capn1 A G 19: 6,007,498 probably null Het
Cep290 A G 10: 100,538,966 Q1358R probably damaging Het
Cfap126 T C 1: 171,125,817 probably benign Het
Chn1 T C 2: 73,679,607 probably benign Het
Cldn8 T C 16: 88,562,401 E212G probably benign Het
Cpb1 T C 3: 20,263,532 N249S probably damaging Het
Cxcr6 A T 9: 123,810,347 I138F probably benign Het
Dab2ip G A 2: 35,718,791 R579H probably damaging Het
Dcaf8 T C 1: 172,193,855 M538T probably benign Het
Dhrs4 T G 14: 55,487,650 L201V probably damaging Het
Dnah12 C T 14: 26,710,248 A407V probably benign Het
Elavl3 T A 9: 22,026,165 probably benign Het
Elp4 T C 2: 105,832,161 H88R probably benign Het
Ercc3 T C 18: 32,261,297 probably benign Het
Eri1 A G 8: 35,469,181 S329P possibly damaging Het
Erich2 A T 2: 70,512,773 probably benign Het
Esyt1 A G 10: 128,512,428 S864P possibly damaging Het
Fam170b A G 14: 32,835,631 E141G probably damaging Het
Fat1 A G 8: 45,033,390 Y3304C probably damaging Het
Fbn1 T C 2: 125,309,495 T2531A probably benign Het
Fgfr3 T C 5: 33,729,750 V166A probably damaging Het
Glt8d2 T C 10: 82,659,538 D194G probably damaging Het
Gpr89 A G 3: 96,905,210 I5T probably benign Het
Gpx6 A T 13: 21,318,920 H168L probably benign Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Ifngr1 A G 10: 19,601,445 D118G probably benign Het
Ipcef1 A T 10: 6,935,173 probably null Het
Kbtbd3 A T 9: 4,330,276 T217S probably benign Het
Kmt5a GAA GA 5: 124,459,885 probably null Het
Lrp1 T C 10: 127,539,011 D4526G probably damaging Het
Lrp1b A T 2: 42,323,662 V46D probably damaging Het
Lsm8 T A 6: 18,849,659 M22K probably benign Het
Map1lc3b C T 8: 121,596,600 R70C possibly damaging Het
Meiob T A 17: 24,813,052 S14T possibly damaging Het
Mkx G T 18: 6,992,330 Y183* probably null Het
Mrs2 T C 13: 25,005,034 Y99C probably benign Het
Mycbpap T C 11: 94,505,561 K151R probably benign Het
Neb T G 2: 52,328,734 Q88P probably damaging Het
Noc4l T A 5: 110,650,078 H319L probably damaging Het
Nt5c2 G A 19: 46,904,978 T122I probably damaging Het
Nuggc A T 14: 65,624,133 N476I probably damaging Het
Obscn T A 11: 59,031,036 H5978L probably benign Het
Oc90 G T 15: 65,876,521 A412D probably damaging Het
Olfr1080 A T 2: 86,553,752 V124E probably damaging Het
Olfr1143 T G 2: 87,802,868 S160A probably benign Het
Olfr1249 A G 2: 89,630,014 S295P possibly damaging Het
Olfr168 T A 16: 19,530,383 D179V possibly damaging Het
Olfr399 A G 11: 74,053,824 *312Q probably null Het
Olfr8 T A 10: 78,955,848 S214R probably benign Het
Pdzrn3 A T 6: 101,150,969 V912E probably benign Het
Phactr1 T A 13: 43,094,990 Y387N probably damaging Het
Picalm T A 7: 90,130,651 C27S probably benign Het
Pkd1l1 T A 11: 8,941,077 I314F possibly damaging Het
Pold2 T C 11: 5,874,175 E210G possibly damaging Het
Ptprz1 C T 6: 23,049,524 probably benign Het
Rac1 G T 5: 143,507,338 A165E probably damaging Het
Rpap3 G T 15: 97,686,483 T360K possibly damaging Het
Scn9a G A 2: 66,526,888 T1012I probably benign Het
Sdad1 A G 5: 92,309,823 I20T possibly damaging Het
Setbp1 T G 18: 78,859,912 K180T probably damaging Het
Sgpl1 T C 10: 61,102,589 N475S probably damaging Het
Shroom3 T C 5: 92,942,834 S1148P possibly damaging Het
Sin3a T A 9: 57,119,158 H1119Q possibly damaging Het
Slc26a7 T A 4: 14,506,489 Y620F probably benign Het
Slc4a1 T C 11: 102,361,171 I36V probably benign Het
Smarca2 C G 19: 26,631,101 P263A possibly damaging Het
Sp100 T C 1: 85,663,521 probably benign Het
Spag6l A G 16: 16,780,614 probably benign Het
Sptbn1 T C 11: 30,121,498 N1491S probably damaging Het
Tbl1xr1 T G 3: 22,190,951 V155G possibly damaging Het
Tmc1 A G 19: 20,868,355 I168T probably damaging Het
Tmem87b G A 2: 128,826,393 probably null Het
Tnfrsf9 T A 4: 150,933,104 probably null Het
Tnni3k T C 3: 154,939,658 D530G probably damaging Het
Vmn1r209 G A 13: 22,805,764 S252F probably damaging Het
Zbtb3 A T 19: 8,803,350 N109I probably damaging Het
Zdhhc17 T G 10: 110,946,210 H541P probably damaging Het
Zfp84 A G 7: 29,776,614 I244V possibly damaging Het
Zyx A G 6: 42,356,312 Y393C probably damaging Het
Other mutations in Gusb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Gusb APN 5 129999381 missense probably damaging 1.00
IGL01561:Gusb APN 5 129998086 missense probably damaging 1.00
IGL02642:Gusb APN 5 130000535 intron probably null
IGL03307:Gusb APN 5 130000031 makesense probably null
R0389:Gusb UTSW 5 129998086 missense probably damaging 1.00
R1512:Gusb UTSW 5 130000890 missense probably damaging 1.00
R2125:Gusb UTSW 5 129999447 missense probably benign 0.00
R2888:Gusb UTSW 5 130000502 missense probably damaging 1.00
R2890:Gusb UTSW 5 130000502 missense probably damaging 1.00
R3017:Gusb UTSW 5 130000484 missense probably damaging 1.00
R4453:Gusb UTSW 5 129998483 missense possibly damaging 0.84
R4906:Gusb UTSW 5 129998118 missense probably damaging 0.98
R4937:Gusb UTSW 5 129995485 missense probably damaging 0.99
R5260:Gusb UTSW 5 129999988 nonsense probably null
R5281:Gusb UTSW 5 129998526 missense probably benign 0.00
R6194:Gusb UTSW 5 129990065 missense possibly damaging 0.46
R6248:Gusb UTSW 5 130000525 missense probably benign 0.01
R7121:Gusb UTSW 5 130000043 missense probably benign 0.44
R7209:Gusb UTSW 5 129998546 missense probably benign
R7768:Gusb UTSW 5 130000405 missense probably benign 0.01
Z1177:Gusb UTSW 5 130002736 missense not run
Predicted Primers PCR Primer
(F):5'- TCTTCCCAGGGCACAGAGGTAG -3'
(R):5'- TACGTAGGCACCAGGGGTGTTG -3'

Sequencing Primer
(F):5'- GGAAGGAGATATCAATGACTCCC -3'
(R):5'- aaccaaaccaaaccaaaacataac -3'
Posted On2014-04-13