Incidental Mutation 'R1496:Olfr8'
ID168878
Institutional Source Beutler Lab
Gene Symbol Olfr8
Ensembl Gene ENSMUSG00000094080
Gene Nameolfactory receptor 8
SynonymsMOR139-5P, GA_x6K02T2QGN0-2857086-2856154
MMRRC Submission 039547-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R1496 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location78950636-78958378 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78955848 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 214 (S214R)
Ref Sequence ENSEMBL: ENSMUSP00000148856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081571] [ENSMUST00000203851] [ENSMUST00000214952]
Predicted Effect probably benign
Transcript: ENSMUST00000081571
AA Change: S214R

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000080282
Gene: ENSMUSG00000094080
AA Change: S214R

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 1.3e-47 PFAM
Pfam:7tm_1 42 291 3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203851
AA Change: S214R

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000144916
Gene: ENSMUSG00000094080
AA Change: S214R

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 1.3e-47 PFAM
Pfam:7tm_1 42 291 3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214952
AA Change: S214R

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216819
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.9%
Validation Efficiency 98% (94/96)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A G 9: 46,310,254 probably benign Het
4933411K16Rik T C 19: 42,053,050 Y207H probably damaging Het
Abcc1 T A 16: 14,448,434 L832Q probably damaging Het
Acan T A 7: 79,100,804 H1774Q probably benign Het
Adss T C 1: 177,772,194 T275A probably benign Het
Ano5 G A 7: 51,583,775 R595H probably damaging Het
Araf G T X: 20,859,704 R522L probably damaging Het
Arhgef28 C T 13: 97,965,546 V807I possibly damaging Het
Bin1 T C 18: 32,412,704 I103T probably damaging Het
C4b C T 17: 34,740,021 R478Q probably benign Het
Cacna1b G A 2: 24,678,035 P1015S probably benign Het
Capn1 A G 19: 6,007,498 probably null Het
Cep290 A G 10: 100,538,966 Q1358R probably damaging Het
Cfap126 T C 1: 171,125,817 probably benign Het
Chn1 T C 2: 73,679,607 probably benign Het
Cldn8 T C 16: 88,562,401 E212G probably benign Het
Cpb1 T C 3: 20,263,532 N249S probably damaging Het
Cxcr6 A T 9: 123,810,347 I138F probably benign Het
Dab2ip G A 2: 35,718,791 R579H probably damaging Het
Dcaf8 T C 1: 172,193,855 M538T probably benign Het
Dhrs4 T G 14: 55,487,650 L201V probably damaging Het
Dnah12 C T 14: 26,710,248 A407V probably benign Het
Elavl3 T A 9: 22,026,165 probably benign Het
Elp4 T C 2: 105,832,161 H88R probably benign Het
Ercc3 T C 18: 32,261,297 probably benign Het
Eri1 A G 8: 35,469,181 S329P possibly damaging Het
Erich2 A T 2: 70,512,773 probably benign Het
Esyt1 A G 10: 128,512,428 S864P possibly damaging Het
Fam170b A G 14: 32,835,631 E141G probably damaging Het
Fat1 A G 8: 45,033,390 Y3304C probably damaging Het
Fbn1 T C 2: 125,309,495 T2531A probably benign Het
Fgfr3 T C 5: 33,729,750 V166A probably damaging Het
Glt8d2 T C 10: 82,659,538 D194G probably damaging Het
Gpr89 A G 3: 96,905,210 I5T probably benign Het
Gpx6 A T 13: 21,318,920 H168L probably benign Het
Gusb T C 5: 129,998,544 T307A probably benign Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Ifngr1 A G 10: 19,601,445 D118G probably benign Het
Ipcef1 A T 10: 6,935,173 probably null Het
Kbtbd3 A T 9: 4,330,276 T217S probably benign Het
Kmt5a GAA GA 5: 124,459,885 probably null Het
Lrp1 T C 10: 127,539,011 D4526G probably damaging Het
Lrp1b A T 2: 42,323,662 V46D probably damaging Het
Lsm8 T A 6: 18,849,659 M22K probably benign Het
Map1lc3b C T 8: 121,596,600 R70C possibly damaging Het
Meiob T A 17: 24,813,052 S14T possibly damaging Het
Mkx G T 18: 6,992,330 Y183* probably null Het
Mrs2 T C 13: 25,005,034 Y99C probably benign Het
Mycbpap T C 11: 94,505,561 K151R probably benign Het
Neb T G 2: 52,328,734 Q88P probably damaging Het
Noc4l T A 5: 110,650,078 H319L probably damaging Het
Nt5c2 G A 19: 46,904,978 T122I probably damaging Het
Nuggc A T 14: 65,624,133 N476I probably damaging Het
Obscn T A 11: 59,031,036 H5978L probably benign Het
Oc90 G T 15: 65,876,521 A412D probably damaging Het
Olfr1080 A T 2: 86,553,752 V124E probably damaging Het
Olfr1143 T G 2: 87,802,868 S160A probably benign Het
Olfr1249 A G 2: 89,630,014 S295P possibly damaging Het
Olfr168 T A 16: 19,530,383 D179V possibly damaging Het
Olfr399 A G 11: 74,053,824 *312Q probably null Het
Pdzrn3 A T 6: 101,150,969 V912E probably benign Het
Phactr1 T A 13: 43,094,990 Y387N probably damaging Het
Picalm T A 7: 90,130,651 C27S probably benign Het
Pkd1l1 T A 11: 8,941,077 I314F possibly damaging Het
Pold2 T C 11: 5,874,175 E210G possibly damaging Het
Ptprz1 C T 6: 23,049,524 probably benign Het
Rac1 G T 5: 143,507,338 A165E probably damaging Het
Rpap3 G T 15: 97,686,483 T360K possibly damaging Het
Scn9a G A 2: 66,526,888 T1012I probably benign Het
Sdad1 A G 5: 92,309,823 I20T possibly damaging Het
Setbp1 T G 18: 78,859,912 K180T probably damaging Het
Sgpl1 T C 10: 61,102,589 N475S probably damaging Het
Shroom3 T C 5: 92,942,834 S1148P possibly damaging Het
Sin3a T A 9: 57,119,158 H1119Q possibly damaging Het
Slc26a7 T A 4: 14,506,489 Y620F probably benign Het
Slc4a1 T C 11: 102,361,171 I36V probably benign Het
Smarca2 C G 19: 26,631,101 P263A possibly damaging Het
Sp100 T C 1: 85,663,521 probably benign Het
Spag6l A G 16: 16,780,614 probably benign Het
Sptbn1 T C 11: 30,121,498 N1491S probably damaging Het
Tbl1xr1 T G 3: 22,190,951 V155G possibly damaging Het
Tmc1 A G 19: 20,868,355 I168T probably damaging Het
Tmem87b G A 2: 128,826,393 probably null Het
Tnfrsf9 T A 4: 150,933,104 probably null Het
Tnni3k T C 3: 154,939,658 D530G probably damaging Het
Vmn1r209 G A 13: 22,805,764 S252F probably damaging Het
Zbtb3 A T 19: 8,803,350 N109I probably damaging Het
Zdhhc17 T G 10: 110,946,210 H541P probably damaging Het
Zfp84 A G 7: 29,776,614 I244V possibly damaging Het
Zyx A G 6: 42,356,312 Y393C probably damaging Het
Other mutations in Olfr8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Olfr8 APN 10 78955354 missense possibly damaging 0.48
IGL01480:Olfr8 APN 10 78956144 utr 3 prime probably benign
IGL02505:Olfr8 APN 10 78955933 missense probably benign 0.02
IGL02543:Olfr8 APN 10 78955939 missense probably damaging 1.00
IGL03323:Olfr8 APN 10 78955600 missense probably benign
PIT4466001:Olfr8 UTSW 10 78955842 missense probably benign 0.00
R1754:Olfr8 UTSW 10 78955697 missense probably damaging 0.99
R1878:Olfr8 UTSW 10 78955805 missense possibly damaging 0.62
R2760:Olfr8 UTSW 10 78956042 missense probably damaging 0.99
R4202:Olfr8 UTSW 10 78955295 missense probably benign
R4206:Olfr8 UTSW 10 78955283 missense probably benign 0.00
R4517:Olfr8 UTSW 10 78956043 nonsense probably null
R4613:Olfr8 UTSW 10 78956065 missense probably damaging 1.00
R4799:Olfr8 UTSW 10 78956097 missense probably null 0.92
R4979:Olfr8 UTSW 10 78955932 nonsense probably null
R5008:Olfr8 UTSW 10 78956071 missense probably damaging 1.00
R5700:Olfr8 UTSW 10 78955484 missense probably damaging 1.00
R5876:Olfr8 UTSW 10 78955357 missense probably benign 0.15
R6439:Olfr8 UTSW 10 78955984 missense probably damaging 1.00
R6930:Olfr8 UTSW 10 78955781 missense possibly damaging 0.84
R7110:Olfr8 UTSW 10 78955450 missense possibly damaging 0.83
R7405:Olfr8 UTSW 10 78955697 missense probably benign 0.14
R7524:Olfr8 UTSW 10 78955491 nonsense probably null
Z1176:Olfr8 UTSW 10 78955219 missense not run
Predicted Primers PCR Primer
(F):5'- TGCTTGGGAACCTGCTCATCATC -3'
(R):5'- GCTTTGGACCACAGCAGAACTGAC -3'

Sequencing Primer
(F):5'- GGCCATTACATATGCAGACTG -3'
(R):5'- AGAACTGACATACACTCCAAGG -3'
Posted On2014-04-13