Incidental Mutation 'R1496:Pold2'
ID168884
Institutional Source Beutler Lab
Gene Symbol Pold2
Ensembl Gene ENSMUSG00000020471
Gene Namepolymerase (DNA directed), delta 2, regulatory subunit
Synonymsp50, 50kDa, po1D2
MMRRC Submission 039547-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1496 (G1)
Quality Score209
Status Validated
Chromosome11
Chromosomal Location5872180-5878292 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5874175 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 210 (E210G)
Ref Sequence ENSEMBL: ENSMUSP00000122906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102922] [ENSMUST00000102923] [ENSMUST00000109829] [ENSMUST00000153995]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102922
AA Change: E210G

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099986
Gene: ENSMUSG00000020471
AA Change: E210G

DomainStartEndE-ValueType
Pfam:DNA_pol_E_B 196 412 1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102923
SMART Domains Protein: ENSMUSP00000099987
Gene: ENSMUSG00000020473

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 46 N/A INTRINSIC
low complexity region 85 102 N/A INTRINSIC
low complexity region 113 159 N/A INTRINSIC
low complexity region 217 229 N/A INTRINSIC
low complexity region 264 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
FA58C 375 531 8.72e-46 SMART
Zn_pept 555 983 5.56e-43 SMART
low complexity region 1005 1029 N/A INTRINSIC
low complexity region 1035 1052 N/A INTRINSIC
low complexity region 1069 1089 N/A INTRINSIC
low complexity region 1092 1106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109829
SMART Domains Protein: ENSMUSP00000105454
Gene: ENSMUSG00000020473

DomainStartEndE-ValueType
FA58C 1 151 2.04e-37 SMART
Zn_pept 175 603 5.56e-43 SMART
low complexity region 625 649 N/A INTRINSIC
low complexity region 655 672 N/A INTRINSIC
low complexity region 689 709 N/A INTRINSIC
low complexity region 712 726 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134957
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141907
Predicted Effect possibly damaging
Transcript: ENSMUST00000153995
AA Change: E210G

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122906
Gene: ENSMUSG00000020471
AA Change: E210G

DomainStartEndE-ValueType
PDB:3E0J|G 1 241 1e-142 PDB
Meta Mutation Damage Score 0.1542 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.9%
Validation Efficiency 98% (94/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 50-kDa catalytic subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. The encoded protein is required for the stimulation of DNA polymerase delta activity by the processivity cofactor proliferating cell nuclear antigen (PCNA). Expression of this gene may be a marker for ovarian carcinomas. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A G 9: 46,310,254 probably benign Het
4933411K16Rik T C 19: 42,053,050 Y207H probably damaging Het
Abcc1 T A 16: 14,448,434 L832Q probably damaging Het
Acan T A 7: 79,100,804 H1774Q probably benign Het
Adss T C 1: 177,772,194 T275A probably benign Het
Ano5 G A 7: 51,583,775 R595H probably damaging Het
Araf G T X: 20,859,704 R522L probably damaging Het
Arhgef28 C T 13: 97,965,546 V807I possibly damaging Het
Bin1 T C 18: 32,412,704 I103T probably damaging Het
C4b C T 17: 34,740,021 R478Q probably benign Het
Cacna1b G A 2: 24,678,035 P1015S probably benign Het
Capn1 A G 19: 6,007,498 probably null Het
Cep290 A G 10: 100,538,966 Q1358R probably damaging Het
Cfap126 T C 1: 171,125,817 probably benign Het
Chn1 T C 2: 73,679,607 probably benign Het
Cldn8 T C 16: 88,562,401 E212G probably benign Het
Cpb1 T C 3: 20,263,532 N249S probably damaging Het
Cxcr6 A T 9: 123,810,347 I138F probably benign Het
Dab2ip G A 2: 35,718,791 R579H probably damaging Het
Dcaf8 T C 1: 172,193,855 M538T probably benign Het
Dhrs4 T G 14: 55,487,650 L201V probably damaging Het
Dnah12 C T 14: 26,710,248 A407V probably benign Het
Elavl3 T A 9: 22,026,165 probably benign Het
Elp4 T C 2: 105,832,161 H88R probably benign Het
Ercc3 T C 18: 32,261,297 probably benign Het
Eri1 A G 8: 35,469,181 S329P possibly damaging Het
Erich2 A T 2: 70,512,773 probably benign Het
Esyt1 A G 10: 128,512,428 S864P possibly damaging Het
Fam170b A G 14: 32,835,631 E141G probably damaging Het
Fat1 A G 8: 45,033,390 Y3304C probably damaging Het
Fbn1 T C 2: 125,309,495 T2531A probably benign Het
Fgfr3 T C 5: 33,729,750 V166A probably damaging Het
Glt8d2 T C 10: 82,659,538 D194G probably damaging Het
Gpr89 A G 3: 96,905,210 I5T probably benign Het
Gpx6 A T 13: 21,318,920 H168L probably benign Het
Gusb T C 5: 129,998,544 T307A probably benign Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Ifngr1 A G 10: 19,601,445 D118G probably benign Het
Ipcef1 A T 10: 6,935,173 probably null Het
Kbtbd3 A T 9: 4,330,276 T217S probably benign Het
Kmt5a GAA GA 5: 124,459,885 probably null Het
Lrp1 T C 10: 127,539,011 D4526G probably damaging Het
Lrp1b A T 2: 42,323,662 V46D probably damaging Het
Lsm8 T A 6: 18,849,659 M22K probably benign Het
Map1lc3b C T 8: 121,596,600 R70C possibly damaging Het
Meiob T A 17: 24,813,052 S14T possibly damaging Het
Mkx G T 18: 6,992,330 Y183* probably null Het
Mrs2 T C 13: 25,005,034 Y99C probably benign Het
Mycbpap T C 11: 94,505,561 K151R probably benign Het
Neb T G 2: 52,328,734 Q88P probably damaging Het
Noc4l T A 5: 110,650,078 H319L probably damaging Het
Nt5c2 G A 19: 46,904,978 T122I probably damaging Het
Nuggc A T 14: 65,624,133 N476I probably damaging Het
Obscn T A 11: 59,031,036 H5978L probably benign Het
Oc90 G T 15: 65,876,521 A412D probably damaging Het
Olfr1080 A T 2: 86,553,752 V124E probably damaging Het
Olfr1143 T G 2: 87,802,868 S160A probably benign Het
Olfr1249 A G 2: 89,630,014 S295P possibly damaging Het
Olfr168 T A 16: 19,530,383 D179V possibly damaging Het
Olfr399 A G 11: 74,053,824 *312Q probably null Het
Olfr8 T A 10: 78,955,848 S214R probably benign Het
Pdzrn3 A T 6: 101,150,969 V912E probably benign Het
Phactr1 T A 13: 43,094,990 Y387N probably damaging Het
Picalm T A 7: 90,130,651 C27S probably benign Het
Pkd1l1 T A 11: 8,941,077 I314F possibly damaging Het
Ptprz1 C T 6: 23,049,524 probably benign Het
Rac1 G T 5: 143,507,338 A165E probably damaging Het
Rpap3 G T 15: 97,686,483 T360K possibly damaging Het
Scn9a G A 2: 66,526,888 T1012I probably benign Het
Sdad1 A G 5: 92,309,823 I20T possibly damaging Het
Setbp1 T G 18: 78,859,912 K180T probably damaging Het
Sgpl1 T C 10: 61,102,589 N475S probably damaging Het
Shroom3 T C 5: 92,942,834 S1148P possibly damaging Het
Sin3a T A 9: 57,119,158 H1119Q possibly damaging Het
Slc26a7 T A 4: 14,506,489 Y620F probably benign Het
Slc4a1 T C 11: 102,361,171 I36V probably benign Het
Smarca2 C G 19: 26,631,101 P263A possibly damaging Het
Sp100 T C 1: 85,663,521 probably benign Het
Spag6l A G 16: 16,780,614 probably benign Het
Sptbn1 T C 11: 30,121,498 N1491S probably damaging Het
Tbl1xr1 T G 3: 22,190,951 V155G possibly damaging Het
Tmc1 A G 19: 20,868,355 I168T probably damaging Het
Tmem87b G A 2: 128,826,393 probably null Het
Tnfrsf9 T A 4: 150,933,104 probably null Het
Tnni3k T C 3: 154,939,658 D530G probably damaging Het
Vmn1r209 G A 13: 22,805,764 S252F probably damaging Het
Zbtb3 A T 19: 8,803,350 N109I probably damaging Het
Zdhhc17 T G 10: 110,946,210 H541P probably damaging Het
Zfp84 A G 7: 29,776,614 I244V possibly damaging Het
Zyx A G 6: 42,356,312 Y393C probably damaging Het
Other mutations in Pold2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Pold2 APN 11 5872412 missense probably benign 0.00
IGL00784:Pold2 APN 11 5872412 missense probably benign 0.00
IGL01014:Pold2 APN 11 5872293 missense probably benign
R0056:Pold2 UTSW 11 5872338 missense possibly damaging 0.82
R0111:Pold2 UTSW 11 5876760 missense probably damaging 1.00
R0392:Pold2 UTSW 11 5876776 missense possibly damaging 0.57
R1023:Pold2 UTSW 11 5875140 missense probably benign 0.01
R1521:Pold2 UTSW 11 5876833 missense probably damaging 0.99
R1835:Pold2 UTSW 11 5873454 missense possibly damaging 0.56
R1836:Pold2 UTSW 11 5873454 missense possibly damaging 0.56
R2032:Pold2 UTSW 11 5876757 missense probably benign
R2055:Pold2 UTSW 11 5873516 nonsense probably null
R5288:Pold2 UTSW 11 5876760 missense probably damaging 1.00
R5384:Pold2 UTSW 11 5876760 missense probably damaging 1.00
R5385:Pold2 UTSW 11 5876760 missense probably damaging 1.00
R5469:Pold2 UTSW 11 5873048 missense probably damaging 1.00
R5470:Pold2 UTSW 11 5873048 missense probably damaging 1.00
R6232:Pold2 UTSW 11 5873691 missense probably benign 0.03
R7147:Pold2 UTSW 11 5873095 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- GAATGATCGACAAGCCCTGAACTCC -3'
(R):5'- AGACCACTGCTTTGCTGACCTG -3'

Sequencing Primer
(F):5'- AGCCATGTTTCCAGGCCAG -3'
(R):5'- TGACCTGGCTCCACAGAAG -3'
Posted On2014-04-13