Incidental Mutation 'R1496:Arhgef28'
ID168895
Institutional Source Beutler Lab
Gene Symbol Arhgef28
Ensembl Gene ENSMUSG00000021662
Gene NameRho guanine nucleotide exchange factor (GEF) 28
SynonymsRhoGEF, Rgnef, Rho specific exchange factor, p190RhoGEF, 9230110L08Rik, D13Bwg1089e, RIP2
MMRRC Submission 039547-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1496 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location97899469-98206439 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 97965546 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 807 (V807I)
Ref Sequence ENSEMBL: ENSMUSP00000105053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109426] [ENSMUST00000225884]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109426
AA Change: V807I

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105053
Gene: ENSMUSG00000021662
AA Change: V807I

DomainStartEndE-ValueType
low complexity region 530 568 N/A INTRINSIC
low complexity region 634 650 N/A INTRINSIC
C1 652 698 1.65e-11 SMART
RhoGEF 850 1040 1.11e-65 SMART
PH 1084 1187 1.08e-9 SMART
low complexity region 1267 1281 N/A INTRINSIC
coiled coil region 1469 1522 N/A INTRINSIC
low complexity region 1647 1663 N/A INTRINSIC
low complexity region 1682 1693 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225663
Predicted Effect possibly damaging
Transcript: ENSMUST00000225884
AA Change: V807I

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.9%
Validation Efficiency 98% (94/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho guanine nucleotide exchange factor family. The encoded protein interacts with low molecular weight neurofilament mRNA and may be involved in the formation of amyotrophic lateral sclerosis neurofilament aggregates. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are born at lower than expected Mendelian ratios and exhibit a reduction in overall size that becomes negligible by 8 weeks of age. Mouse embryonic fibroblasts display defects in cell migration and focal adhesion formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A G 9: 46,310,254 probably benign Het
4933411K16Rik T C 19: 42,053,050 Y207H probably damaging Het
Abcc1 T A 16: 14,448,434 L832Q probably damaging Het
Acan T A 7: 79,100,804 H1774Q probably benign Het
Adss T C 1: 177,772,194 T275A probably benign Het
Ano5 G A 7: 51,583,775 R595H probably damaging Het
Araf G T X: 20,859,704 R522L probably damaging Het
Bin1 T C 18: 32,412,704 I103T probably damaging Het
C4b C T 17: 34,740,021 R478Q probably benign Het
Cacna1b G A 2: 24,678,035 P1015S probably benign Het
Capn1 A G 19: 6,007,498 probably null Het
Cep290 A G 10: 100,538,966 Q1358R probably damaging Het
Cfap126 T C 1: 171,125,817 probably benign Het
Chn1 T C 2: 73,679,607 probably benign Het
Cldn8 T C 16: 88,562,401 E212G probably benign Het
Cpb1 T C 3: 20,263,532 N249S probably damaging Het
Cxcr6 A T 9: 123,810,347 I138F probably benign Het
Dab2ip G A 2: 35,718,791 R579H probably damaging Het
Dcaf8 T C 1: 172,193,855 M538T probably benign Het
Dhrs4 T G 14: 55,487,650 L201V probably damaging Het
Dnah12 C T 14: 26,710,248 A407V probably benign Het
Elavl3 T A 9: 22,026,165 probably benign Het
Elp4 T C 2: 105,832,161 H88R probably benign Het
Ercc3 T C 18: 32,261,297 probably benign Het
Eri1 A G 8: 35,469,181 S329P possibly damaging Het
Erich2 A T 2: 70,512,773 probably benign Het
Esyt1 A G 10: 128,512,428 S864P possibly damaging Het
Fam170b A G 14: 32,835,631 E141G probably damaging Het
Fat1 A G 8: 45,033,390 Y3304C probably damaging Het
Fbn1 T C 2: 125,309,495 T2531A probably benign Het
Fgfr3 T C 5: 33,729,750 V166A probably damaging Het
Glt8d2 T C 10: 82,659,538 D194G probably damaging Het
Gpr89 A G 3: 96,905,210 I5T probably benign Het
Gpx6 A T 13: 21,318,920 H168L probably benign Het
Gusb T C 5: 129,998,544 T307A probably benign Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Ifngr1 A G 10: 19,601,445 D118G probably benign Het
Ipcef1 A T 10: 6,935,173 probably null Het
Kbtbd3 A T 9: 4,330,276 T217S probably benign Het
Kmt5a GAA GA 5: 124,459,885 probably null Het
Lrp1 T C 10: 127,539,011 D4526G probably damaging Het
Lrp1b A T 2: 42,323,662 V46D probably damaging Het
Lsm8 T A 6: 18,849,659 M22K probably benign Het
Map1lc3b C T 8: 121,596,600 R70C possibly damaging Het
Meiob T A 17: 24,813,052 S14T possibly damaging Het
Mkx G T 18: 6,992,330 Y183* probably null Het
Mrs2 T C 13: 25,005,034 Y99C probably benign Het
Mycbpap T C 11: 94,505,561 K151R probably benign Het
Neb T G 2: 52,328,734 Q88P probably damaging Het
Noc4l T A 5: 110,650,078 H319L probably damaging Het
Nt5c2 G A 19: 46,904,978 T122I probably damaging Het
Nuggc A T 14: 65,624,133 N476I probably damaging Het
Obscn T A 11: 59,031,036 H5978L probably benign Het
Oc90 G T 15: 65,876,521 A412D probably damaging Het
Olfr1080 A T 2: 86,553,752 V124E probably damaging Het
Olfr1143 T G 2: 87,802,868 S160A probably benign Het
Olfr1249 A G 2: 89,630,014 S295P possibly damaging Het
Olfr168 T A 16: 19,530,383 D179V possibly damaging Het
Olfr399 A G 11: 74,053,824 *312Q probably null Het
Olfr8 T A 10: 78,955,848 S214R probably benign Het
Pdzrn3 A T 6: 101,150,969 V912E probably benign Het
Phactr1 T A 13: 43,094,990 Y387N probably damaging Het
Picalm T A 7: 90,130,651 C27S probably benign Het
Pkd1l1 T A 11: 8,941,077 I314F possibly damaging Het
Pold2 T C 11: 5,874,175 E210G possibly damaging Het
Ptprz1 C T 6: 23,049,524 probably benign Het
Rac1 G T 5: 143,507,338 A165E probably damaging Het
Rpap3 G T 15: 97,686,483 T360K possibly damaging Het
Scn9a G A 2: 66,526,888 T1012I probably benign Het
Sdad1 A G 5: 92,309,823 I20T possibly damaging Het
Setbp1 T G 18: 78,859,912 K180T probably damaging Het
Sgpl1 T C 10: 61,102,589 N475S probably damaging Het
Shroom3 T C 5: 92,942,834 S1148P possibly damaging Het
Sin3a T A 9: 57,119,158 H1119Q possibly damaging Het
Slc26a7 T A 4: 14,506,489 Y620F probably benign Het
Slc4a1 T C 11: 102,361,171 I36V probably benign Het
Smarca2 C G 19: 26,631,101 P263A possibly damaging Het
Sp100 T C 1: 85,663,521 probably benign Het
Spag6l A G 16: 16,780,614 probably benign Het
Sptbn1 T C 11: 30,121,498 N1491S probably damaging Het
Tbl1xr1 T G 3: 22,190,951 V155G possibly damaging Het
Tmc1 A G 19: 20,868,355 I168T probably damaging Het
Tmem87b G A 2: 128,826,393 probably null Het
Tnfrsf9 T A 4: 150,933,104 probably null Het
Tnni3k T C 3: 154,939,658 D530G probably damaging Het
Vmn1r209 G A 13: 22,805,764 S252F probably damaging Het
Zbtb3 A T 19: 8,803,350 N109I probably damaging Het
Zdhhc17 T G 10: 110,946,210 H541P probably damaging Het
Zfp84 A G 7: 29,776,614 I244V possibly damaging Het
Zyx A G 6: 42,356,312 Y393C probably damaging Het
Other mutations in Arhgef28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Arhgef28 APN 13 97988277 missense probably benign 0.15
IGL00945:Arhgef28 APN 13 97967399 missense possibly damaging 0.88
IGL01099:Arhgef28 APN 13 97953972 splice site probably benign
IGL01328:Arhgef28 APN 13 97970323 missense probably damaging 1.00
IGL01396:Arhgef28 APN 13 97953893 missense probably damaging 0.99
IGL02067:Arhgef28 APN 13 98077317 missense probably damaging 1.00
IGL02147:Arhgef28 APN 13 97961314 missense probably damaging 1.00
IGL02285:Arhgef28 APN 13 98051028 missense possibly damaging 0.85
IGL02439:Arhgef28 APN 13 97931139 missense possibly damaging 0.75
IGL02499:Arhgef28 APN 13 97953783 missense possibly damaging 0.87
IGL02532:Arhgef28 APN 13 98029883 missense probably damaging 0.99
IGL02634:Arhgef28 APN 13 98051058 missense probably benign 0.00
IGL02902:Arhgef28 APN 13 97946875 missense probably damaging 1.00
IGL03067:Arhgef28 APN 13 97988286 missense probably benign 0.00
IGL03081:Arhgef28 APN 13 98029373 splice site probably benign
IGL03106:Arhgef28 APN 13 97957793 missense probably damaging 1.00
IGL03195:Arhgef28 APN 13 97951563 splice site probably null
IGL03325:Arhgef28 APN 13 97899816 missense probably benign 0.03
H8786:Arhgef28 UTSW 13 97946953 missense probably damaging 1.00
R0027:Arhgef28 UTSW 13 97945696 missense possibly damaging 0.94
R0027:Arhgef28 UTSW 13 97945696 missense possibly damaging 0.94
R0062:Arhgef28 UTSW 13 97956642 missense possibly damaging 0.56
R0062:Arhgef28 UTSW 13 97956642 missense possibly damaging 0.56
R0090:Arhgef28 UTSW 13 98075110 missense probably damaging 0.99
R0096:Arhgef28 UTSW 13 97931254 missense probably damaging 1.00
R0096:Arhgef28 UTSW 13 97931254 missense probably damaging 1.00
R0537:Arhgef28 UTSW 13 97957716 missense probably damaging 1.00
R0617:Arhgef28 UTSW 13 97970355 missense probably benign 0.21
R0711:Arhgef28 UTSW 13 97931254 missense probably damaging 1.00
R0723:Arhgef28 UTSW 13 97939479 missense probably benign 0.16
R0790:Arhgef28 UTSW 13 97981406 missense possibly damaging 0.51
R1240:Arhgef28 UTSW 13 97929492 missense probably benign 0.00
R1365:Arhgef28 UTSW 13 98075124 missense probably damaging 1.00
R1456:Arhgef28 UTSW 13 98075002 missense probably benign 0.01
R1490:Arhgef28 UTSW 13 97978444 missense probably damaging 1.00
R1660:Arhgef28 UTSW 13 97981376 missense probably benign 0.05
R1671:Arhgef28 UTSW 13 97931034 missense possibly damaging 0.95
R1747:Arhgef28 UTSW 13 97936824 missense probably damaging 1.00
R1792:Arhgef28 UTSW 13 97931186 missense probably benign 0.03
R1864:Arhgef28 UTSW 13 97994132 missense probably benign 0.00
R1887:Arhgef28 UTSW 13 98145573 missense probably damaging 0.97
R1924:Arhgef28 UTSW 13 97936816 splice site probably benign
R1987:Arhgef28 UTSW 13 97967096 missense probably benign
R2215:Arhgef28 UTSW 13 98051021 missense possibly damaging 0.78
R2342:Arhgef28 UTSW 13 97994029 missense probably benign 0.00
R2495:Arhgef28 UTSW 13 98029373 splice site probably benign
R3897:Arhgef28 UTSW 13 97956576 missense probably damaging 1.00
R3922:Arhgef28 UTSW 13 97993944 missense possibly damaging 0.92
R4063:Arhgef28 UTSW 13 97994067 missense probably benign 0.16
R4086:Arhgef28 UTSW 13 97967204 missense probably damaging 0.98
R4543:Arhgef28 UTSW 13 98075000 missense probably benign 0.00
R4730:Arhgef28 UTSW 13 97978142 missense probably benign 0.00
R4735:Arhgef28 UTSW 13 97899729 missense probably damaging 1.00
R4953:Arhgef28 UTSW 13 97929554 missense possibly damaging 0.51
R5069:Arhgef28 UTSW 13 98075206 missense probably damaging 0.96
R5558:Arhgef28 UTSW 13 97961460 missense probably damaging 1.00
R5573:Arhgef28 UTSW 13 97929491 missense probably benign 0.01
R5594:Arhgef28 UTSW 13 97939492 missense probably benign 0.00
R5937:Arhgef28 UTSW 13 97939543 missense probably benign 0.00
R5987:Arhgef28 UTSW 13 97936860 nonsense probably null
R6015:Arhgef28 UTSW 13 98075022 missense possibly damaging 0.73
R6193:Arhgef28 UTSW 13 97985380 missense probably damaging 1.00
R6209:Arhgef28 UTSW 13 97929409 critical splice donor site probably null
R6306:Arhgef28 UTSW 13 97985388 missense probably damaging 1.00
R6393:Arhgef28 UTSW 13 97994019 missense possibly damaging 0.64
R6562:Arhgef28 UTSW 13 97988139 critical splice donor site probably null
R6646:Arhgef28 UTSW 13 97939494 missense probably benign 0.09
R6655:Arhgef28 UTSW 13 97899655 missense probably damaging 1.00
R6707:Arhgef28 UTSW 13 97936716 missense probably damaging 0.96
R6707:Arhgef28 UTSW 13 98075116 missense possibly damaging 0.80
R6751:Arhgef28 UTSW 13 98075247 missense probably damaging 0.97
R6940:Arhgef28 UTSW 13 97965530 missense possibly damaging 0.58
R7018:Arhgef28 UTSW 13 97965435 missense probably damaging 1.00
R7030:Arhgef28 UTSW 13 97988261 missense possibly damaging 0.88
R7120:Arhgef28 UTSW 13 97944539 missense probably damaging 1.00
R7266:Arhgef28 UTSW 13 97965452 missense probably benign
R7353:Arhgef28 UTSW 13 98075202 missense probably damaging 1.00
R7368:Arhgef28 UTSW 13 97996862 missense probably benign 0.34
R7491:Arhgef28 UTSW 13 97944686 missense probably benign 0.03
R7500:Arhgef28 UTSW 13 97978495 missense probably benign 0.00
R7653:Arhgef28 UTSW 13 97969313 missense probably benign 0.04
R7813:Arhgef28 UTSW 13 97945681 missense possibly damaging 0.48
Z1088:Arhgef28 UTSW 13 97945691 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGGGGCATATTTGAAATGCTCAC -3'
(R):5'- TCTGAAGGTCACCAAGGAAAACGC -3'

Sequencing Primer
(F):5'- TGCTCACCAAAAATGACATCTTG -3'
(R):5'- GCAGTTCCTGTTGGAGACC -3'
Posted On2014-04-13