Incidental Mutation 'R1496:Spag6l'
ID168904
Institutional Source Beutler Lab
Gene Symbol Spag6l
Ensembl Gene ENSMUSG00000022783
Gene Namesperm associated antigen 6-like
SynonymsPF16, Spag6
MMRRC Submission 039547-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R1496 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location16753016-16829456 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 16780614 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023468]
Predicted Effect probably benign
Transcript: ENSMUST00000023468
SMART Domains Protein: ENSMUSP00000023468
Gene: ENSMUSG00000022783

DomainStartEndE-ValueType
ARM 30 70 2.26e-3 SMART
Blast:ARM 72 112 3e-15 BLAST
ARM 114 154 3e-8 SMART
ARM 156 196 4.91e-4 SMART
ARM 198 238 1.03e-6 SMART
ARM 240 280 3.13e0 SMART
ARM 282 322 4.82e1 SMART
ARM 323 365 7.34e-3 SMART
Blast:ARM 367 409 7e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154624
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.9%
Validation Efficiency 98% (94/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein expressed by this gene is recognized by anti-sperm antibodies from an infertile man. This protein localizes to the tail of permeabilized human sperm and contains eight contiguous armadillo repeats, a motif known to mediate protein-protein interactions. Studies in mice suggest that this protein is involved in sperm flagellar motility and maintenance of the structural integrity of mature sperm. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Many homozygotes for a targeted null mutation exhibit reduced growth, hydrocephaly, and lethality by 8 weeks of age. Surviving males have sperm defects and are infertile, while females show reduced fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A G 9: 46,310,254 probably benign Het
4933411K16Rik T C 19: 42,053,050 Y207H probably damaging Het
Abcc1 T A 16: 14,448,434 L832Q probably damaging Het
Acan T A 7: 79,100,804 H1774Q probably benign Het
Adss T C 1: 177,772,194 T275A probably benign Het
Ano5 G A 7: 51,583,775 R595H probably damaging Het
Araf G T X: 20,859,704 R522L probably damaging Het
Arhgef28 C T 13: 97,965,546 V807I possibly damaging Het
Bin1 T C 18: 32,412,704 I103T probably damaging Het
C4b C T 17: 34,740,021 R478Q probably benign Het
Cacna1b G A 2: 24,678,035 P1015S probably benign Het
Capn1 A G 19: 6,007,498 probably null Het
Cep290 A G 10: 100,538,966 Q1358R probably damaging Het
Cfap126 T C 1: 171,125,817 probably benign Het
Chn1 T C 2: 73,679,607 probably benign Het
Cldn8 T C 16: 88,562,401 E212G probably benign Het
Cpb1 T C 3: 20,263,532 N249S probably damaging Het
Cxcr6 A T 9: 123,810,347 I138F probably benign Het
Dab2ip G A 2: 35,718,791 R579H probably damaging Het
Dcaf8 T C 1: 172,193,855 M538T probably benign Het
Dhrs4 T G 14: 55,487,650 L201V probably damaging Het
Dnah12 C T 14: 26,710,248 A407V probably benign Het
Elavl3 T A 9: 22,026,165 probably benign Het
Elp4 T C 2: 105,832,161 H88R probably benign Het
Ercc3 T C 18: 32,261,297 probably benign Het
Eri1 A G 8: 35,469,181 S329P possibly damaging Het
Erich2 A T 2: 70,512,773 probably benign Het
Esyt1 A G 10: 128,512,428 S864P possibly damaging Het
Fam170b A G 14: 32,835,631 E141G probably damaging Het
Fat1 A G 8: 45,033,390 Y3304C probably damaging Het
Fbn1 T C 2: 125,309,495 T2531A probably benign Het
Fgfr3 T C 5: 33,729,750 V166A probably damaging Het
Glt8d2 T C 10: 82,659,538 D194G probably damaging Het
Gpr89 A G 3: 96,905,210 I5T probably benign Het
Gpx6 A T 13: 21,318,920 H168L probably benign Het
Gusb T C 5: 129,998,544 T307A probably benign Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Ifngr1 A G 10: 19,601,445 D118G probably benign Het
Ipcef1 A T 10: 6,935,173 probably null Het
Kbtbd3 A T 9: 4,330,276 T217S probably benign Het
Kmt5a GAA GA 5: 124,459,885 probably null Het
Lrp1 T C 10: 127,539,011 D4526G probably damaging Het
Lrp1b A T 2: 42,323,662 V46D probably damaging Het
Lsm8 T A 6: 18,849,659 M22K probably benign Het
Map1lc3b C T 8: 121,596,600 R70C possibly damaging Het
Meiob T A 17: 24,813,052 S14T possibly damaging Het
Mkx G T 18: 6,992,330 Y183* probably null Het
Mrs2 T C 13: 25,005,034 Y99C probably benign Het
Mycbpap T C 11: 94,505,561 K151R probably benign Het
Neb T G 2: 52,328,734 Q88P probably damaging Het
Noc4l T A 5: 110,650,078 H319L probably damaging Het
Nt5c2 G A 19: 46,904,978 T122I probably damaging Het
Nuggc A T 14: 65,624,133 N476I probably damaging Het
Obscn T A 11: 59,031,036 H5978L probably benign Het
Oc90 G T 15: 65,876,521 A412D probably damaging Het
Olfr1080 A T 2: 86,553,752 V124E probably damaging Het
Olfr1143 T G 2: 87,802,868 S160A probably benign Het
Olfr1249 A G 2: 89,630,014 S295P possibly damaging Het
Olfr168 T A 16: 19,530,383 D179V possibly damaging Het
Olfr399 A G 11: 74,053,824 *312Q probably null Het
Olfr8 T A 10: 78,955,848 S214R probably benign Het
Pdzrn3 A T 6: 101,150,969 V912E probably benign Het
Phactr1 T A 13: 43,094,990 Y387N probably damaging Het
Picalm T A 7: 90,130,651 C27S probably benign Het
Pkd1l1 T A 11: 8,941,077 I314F possibly damaging Het
Pold2 T C 11: 5,874,175 E210G possibly damaging Het
Ptprz1 C T 6: 23,049,524 probably benign Het
Rac1 G T 5: 143,507,338 A165E probably damaging Het
Rpap3 G T 15: 97,686,483 T360K possibly damaging Het
Scn9a G A 2: 66,526,888 T1012I probably benign Het
Sdad1 A G 5: 92,309,823 I20T possibly damaging Het
Setbp1 T G 18: 78,859,912 K180T probably damaging Het
Sgpl1 T C 10: 61,102,589 N475S probably damaging Het
Shroom3 T C 5: 92,942,834 S1148P possibly damaging Het
Sin3a T A 9: 57,119,158 H1119Q possibly damaging Het
Slc26a7 T A 4: 14,506,489 Y620F probably benign Het
Slc4a1 T C 11: 102,361,171 I36V probably benign Het
Smarca2 C G 19: 26,631,101 P263A possibly damaging Het
Sp100 T C 1: 85,663,521 probably benign Het
Sptbn1 T C 11: 30,121,498 N1491S probably damaging Het
Tbl1xr1 T G 3: 22,190,951 V155G possibly damaging Het
Tmc1 A G 19: 20,868,355 I168T probably damaging Het
Tmem87b G A 2: 128,826,393 probably null Het
Tnfrsf9 T A 4: 150,933,104 probably null Het
Tnni3k T C 3: 154,939,658 D530G probably damaging Het
Vmn1r209 G A 13: 22,805,764 S252F probably damaging Het
Zbtb3 A T 19: 8,803,350 N109I probably damaging Het
Zdhhc17 T G 10: 110,946,210 H541P probably damaging Het
Zfp84 A G 7: 29,776,614 I244V possibly damaging Het
Zyx A G 6: 42,356,312 Y393C probably damaging Het
Other mutations in Spag6l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Spag6l APN 16 16780733 missense probably benign 0.20
IGL00928:Spag6l APN 16 16767013 missense possibly damaging 0.52
IGL00929:Spag6l APN 16 16767013 missense possibly damaging 0.52
IGL01793:Spag6l APN 16 16781857 missense probably damaging 1.00
IGL02380:Spag6l APN 16 16763169 critical splice acceptor site probably null
IGL03271:Spag6l APN 16 16780728 missense probably damaging 1.00
R0284:Spag6l UTSW 16 16780766 missense probably damaging 0.99
R0394:Spag6l UTSW 16 16780629 missense probably benign
R0720:Spag6l UTSW 16 16767096 splice site probably benign
R1205:Spag6l UTSW 16 16787307 missense probably damaging 1.00
R1707:Spag6l UTSW 16 16780628 missense probably benign 0.00
R1926:Spag6l UTSW 16 16763057 missense probably benign 0.00
R2255:Spag6l UTSW 16 16777339 missense probably damaging 0.96
R2330:Spag6l UTSW 16 16829085 missense probably benign
R3755:Spag6l UTSW 16 16763020 critical splice donor site probably null
R3796:Spag6l UTSW 16 16763052 missense probably damaging 1.00
R4093:Spag6l UTSW 16 16829024 missense probably benign 0.05
R4324:Spag6l UTSW 16 16787235 missense probably benign 0.00
R4725:Spag6l UTSW 16 16792531 missense probably damaging 1.00
R4766:Spag6l UTSW 16 16777390 missense probably benign 0.03
R4877:Spag6l UTSW 16 16781758 missense possibly damaging 0.47
R5753:Spag6l UTSW 16 16766967 critical splice donor site probably null
R5958:Spag6l UTSW 16 16763021 critical splice donor site probably null
R6107:Spag6l UTSW 16 16781788 missense possibly damaging 0.56
R6894:Spag6l UTSW 16 16783938 missense probably damaging 1.00
R7329:Spag6l UTSW 16 16767019 missense probably benign
R7634:Spag6l UTSW 16 16777414 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGTACCCAAGGAAGGAAGCCATTTG -3'
(R):5'- AGCTGATTGTTAATGCAGGAGGCG -3'

Sequencing Primer
(F):5'- gacgcaactgacttggaac -3'
(R):5'- TTGCATTGGGTCCTGCAA -3'
Posted On2014-04-13