Incidental Mutation 'R1496:C4b'
ID 168908
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Name complement C4B (Chido blood group)
Synonyms Ss, C4
MMRRC Submission 039547-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1496 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 34947354-34962856 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 34958995 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 478 (R478Q)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
AlphaFold P01029
Predicted Effect probably benign
Transcript: ENSMUST00000069507
AA Change: R478Q

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: R478Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173057
SMART Domains Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
Pfam:A2M 1 62 6.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174597
Meta Mutation Damage Score 0.2649 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.9%
Validation Efficiency 98% (94/96)
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A G 9: 46,221,552 (GRCm39) probably benign Het
4933411K16Rik T C 19: 42,041,489 (GRCm39) Y207H probably damaging Het
Abcc1 T A 16: 14,266,298 (GRCm39) L832Q probably damaging Het
Acan T A 7: 78,750,552 (GRCm39) H1774Q probably benign Het
Adss2 T C 1: 177,599,760 (GRCm39) T275A probably benign Het
Ano5 G A 7: 51,233,523 (GRCm39) R595H probably damaging Het
Araf G T X: 20,725,943 (GRCm39) R522L probably damaging Het
Arhgef28 C T 13: 98,102,054 (GRCm39) V807I possibly damaging Het
Bin1 T C 18: 32,545,757 (GRCm39) I103T probably damaging Het
Cacna1b G A 2: 24,568,047 (GRCm39) P1015S probably benign Het
Capn1 A G 19: 6,057,528 (GRCm39) probably null Het
Cep290 A G 10: 100,374,828 (GRCm39) Q1358R probably damaging Het
Cfap126 T C 1: 170,953,386 (GRCm39) probably benign Het
Chn1 T C 2: 73,509,951 (GRCm39) probably benign Het
Cldn8 T C 16: 88,359,289 (GRCm39) E212G probably benign Het
Cpb1 T C 3: 20,317,696 (GRCm39) N249S probably damaging Het
Cxcr6 A T 9: 123,639,412 (GRCm39) I138F probably benign Het
Dab2ip G A 2: 35,608,803 (GRCm39) R579H probably damaging Het
Dcaf8 T C 1: 172,021,422 (GRCm39) M538T probably benign Het
Dhrs4 T G 14: 55,725,107 (GRCm39) L201V probably damaging Het
Dnah12 C T 14: 26,431,403 (GRCm39) A407V probably benign Het
Elavl3 T A 9: 21,937,461 (GRCm39) probably benign Het
Elp4 T C 2: 105,662,506 (GRCm39) H88R probably benign Het
Ercc3 T C 18: 32,394,350 (GRCm39) probably benign Het
Eri1 A G 8: 35,936,335 (GRCm39) S329P possibly damaging Het
Erich2 A T 2: 70,343,117 (GRCm39) probably benign Het
Esyt1 A G 10: 128,348,297 (GRCm39) S864P possibly damaging Het
Fam170b A G 14: 32,557,588 (GRCm39) E141G probably damaging Het
Fat1 A G 8: 45,486,427 (GRCm39) Y3304C probably damaging Het
Fbn1 T C 2: 125,151,415 (GRCm39) T2531A probably benign Het
Fgfr3 T C 5: 33,887,094 (GRCm39) V166A probably damaging Het
Glt8d2 T C 10: 82,495,372 (GRCm39) D194G probably damaging Het
Gpr89 A G 3: 96,812,526 (GRCm39) I5T probably benign Het
Gpx6 A T 13: 21,503,090 (GRCm39) H168L probably benign Het
Gusb T C 5: 130,027,385 (GRCm39) T307A probably benign Het
Hjurp A T 1: 88,202,772 (GRCm39) Y71N possibly damaging Het
Ifngr1 A G 10: 19,477,193 (GRCm39) D118G probably benign Het
Ipcef1 A T 10: 6,885,173 (GRCm39) probably null Het
Kbtbd3 A T 9: 4,330,276 (GRCm39) T217S probably benign Het
Kmt5a GAA GA 5: 124,597,948 (GRCm39) probably null Het
Lrp1 T C 10: 127,374,880 (GRCm39) D4526G probably damaging Het
Lrp1b A T 2: 42,213,674 (GRCm39) V46D probably damaging Het
Lsm8 T A 6: 18,849,658 (GRCm39) M22K probably benign Het
Map1lc3b C T 8: 122,323,339 (GRCm39) R70C possibly damaging Het
Meiob T A 17: 25,032,026 (GRCm39) S14T possibly damaging Het
Mkx G T 18: 6,992,330 (GRCm39) Y183* probably null Het
Mrs2 T C 13: 25,189,017 (GRCm39) Y99C probably benign Het
Mycbpap T C 11: 94,396,387 (GRCm39) K151R probably benign Het
Neb T G 2: 52,218,746 (GRCm39) Q88P probably damaging Het
Noc4l T A 5: 110,797,944 (GRCm39) H319L probably damaging Het
Nt5c2 G A 19: 46,893,417 (GRCm39) T122I probably damaging Het
Nuggc A T 14: 65,861,582 (GRCm39) N476I probably damaging Het
Obscn T A 11: 58,921,862 (GRCm39) H5978L probably benign Het
Oc90 G T 15: 65,748,370 (GRCm39) A412D probably damaging Het
Or2l13b T A 16: 19,349,133 (GRCm39) D179V possibly damaging Het
Or3a4 A G 11: 73,944,650 (GRCm39) *312Q probably null Het
Or4a76 A G 2: 89,460,358 (GRCm39) S295P possibly damaging Het
Or5w18 T G 2: 87,633,212 (GRCm39) S160A probably benign Het
Or7a42 T A 10: 78,791,682 (GRCm39) S214R probably benign Het
Or8k33 A T 2: 86,384,096 (GRCm39) V124E probably damaging Het
Pdzrn3 A T 6: 101,127,930 (GRCm39) V912E probably benign Het
Phactr1 T A 13: 43,248,466 (GRCm39) Y387N probably damaging Het
Picalm T A 7: 89,779,859 (GRCm39) C27S probably benign Het
Pkd1l1 T A 11: 8,891,077 (GRCm39) I314F possibly damaging Het
Pold2 T C 11: 5,824,175 (GRCm39) E210G possibly damaging Het
Ptprz1 C T 6: 23,049,523 (GRCm39) probably benign Het
Rac1 G T 5: 143,493,093 (GRCm39) A165E probably damaging Het
Rpap3 G T 15: 97,584,364 (GRCm39) T360K possibly damaging Het
Scn9a G A 2: 66,357,232 (GRCm39) T1012I probably benign Het
Sdad1 A G 5: 92,457,682 (GRCm39) I20T possibly damaging Het
Setbp1 T G 18: 78,903,127 (GRCm39) K180T probably damaging Het
Sgpl1 T C 10: 60,938,368 (GRCm39) N475S probably damaging Het
Shroom3 T C 5: 93,090,693 (GRCm39) S1148P possibly damaging Het
Sin3a T A 9: 57,026,442 (GRCm39) H1119Q possibly damaging Het
Slc26a7 T A 4: 14,506,489 (GRCm39) Y620F probably benign Het
Slc4a1 T C 11: 102,251,997 (GRCm39) I36V probably benign Het
Smarca2 C G 19: 26,608,501 (GRCm39) P263A possibly damaging Het
Sp100 T C 1: 85,591,242 (GRCm39) probably benign Het
Spag6l A G 16: 16,598,478 (GRCm39) probably benign Het
Sptbn1 T C 11: 30,071,498 (GRCm39) N1491S probably damaging Het
Tbl1xr1 T G 3: 22,245,115 (GRCm39) V155G possibly damaging Het
Tmc1 A G 19: 20,845,719 (GRCm39) I168T probably damaging Het
Tmem87b G A 2: 128,668,313 (GRCm39) probably null Het
Tnfrsf9 T A 4: 151,017,561 (GRCm39) probably null Het
Tnni3k T C 3: 154,645,295 (GRCm39) D530G probably damaging Het
Vmn1r209 G A 13: 22,989,934 (GRCm39) S252F probably damaging Het
Zbtb3 A T 19: 8,780,714 (GRCm39) N109I probably damaging Het
Zdhhc17 T G 10: 110,782,071 (GRCm39) H541P probably damaging Het
Zfp84 A G 7: 29,476,039 (GRCm39) I244V possibly damaging Het
Zyx A G 6: 42,333,246 (GRCm39) Y393C probably damaging Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34,953,402 (GRCm39) missense probably damaging 1.00
IGL00433:C4b APN 17 34,961,015 (GRCm39) missense possibly damaging 0.75
IGL00471:C4b APN 17 34,953,403 (GRCm39) missense probably damaging 1.00
IGL00515:C4b APN 17 34,947,865 (GRCm39) missense probably damaging 1.00
IGL01599:C4b APN 17 34,961,993 (GRCm39) splice site probably benign
IGL01761:C4b APN 17 34,958,912 (GRCm39) missense possibly damaging 0.56
IGL02004:C4b APN 17 34,957,984 (GRCm39) unclassified probably benign
IGL02215:C4b APN 17 34,953,465 (GRCm39) missense probably damaging 1.00
IGL02517:C4b APN 17 34,953,382 (GRCm39) missense probably benign 0.01
IGL02926:C4b APN 17 34,949,686 (GRCm39) missense possibly damaging 0.95
IGL03031:C4b APN 17 34,950,104 (GRCm39) missense possibly damaging 0.47
IGL03057:C4b APN 17 34,956,738 (GRCm39) unclassified probably benign
IGL03165:C4b APN 17 34,958,929 (GRCm39) missense probably benign 0.13
IGL03380:C4b APN 17 34,959,260 (GRCm39) missense probably benign 0.01
Aspiration UTSW 17 34,953,416 (GRCm39) missense probably benign 0.00
Inspiration UTSW 17 34,951,140 (GRCm39) splice site probably null
Peroration UTSW 17 34,948,373 (GRCm39) critical splice donor site probably null
perspiration UTSW 17 34,948,805 (GRCm39) missense probably damaging 1.00
FR4548:C4b UTSW 17 34,959,971 (GRCm39) missense probably benign 0.00
PIT4142001:C4b UTSW 17 34,952,675 (GRCm39) missense probably benign 0.01
R0064:C4b UTSW 17 34,957,830 (GRCm39) missense probably damaging 1.00
R0113:C4b UTSW 17 34,960,214 (GRCm39) missense probably damaging 0.98
R0143:C4b UTSW 17 34,953,193 (GRCm39) unclassified probably benign
R0254:C4b UTSW 17 34,953,750 (GRCm39) missense probably benign 0.00
R0320:C4b UTSW 17 34,952,135 (GRCm39) missense probably benign 0.01
R0391:C4b UTSW 17 34,954,588 (GRCm39) splice site probably benign
R0399:C4b UTSW 17 34,947,843 (GRCm39) missense probably damaging 1.00
R0467:C4b UTSW 17 34,955,101 (GRCm39) missense probably benign 0.01
R0549:C4b UTSW 17 34,954,389 (GRCm39) missense probably damaging 1.00
R0561:C4b UTSW 17 34,953,391 (GRCm39) missense probably damaging 0.99
R0662:C4b UTSW 17 34,949,862 (GRCm39) missense probably damaging 1.00
R0941:C4b UTSW 17 34,959,029 (GRCm39) missense probably benign
R1161:C4b UTSW 17 34,948,567 (GRCm39) missense probably damaging 1.00
R1169:C4b UTSW 17 34,961,946 (GRCm39) missense probably benign 0.14
R1186:C4b UTSW 17 34,955,283 (GRCm39) missense possibly damaging 0.47
R1310:C4b UTSW 17 34,948,567 (GRCm39) missense probably damaging 1.00
R1398:C4b UTSW 17 34,949,693 (GRCm39) unclassified probably benign
R1472:C4b UTSW 17 34,962,743 (GRCm39) nonsense probably null
R1544:C4b UTSW 17 34,957,941 (GRCm39) missense probably benign 0.13
R1588:C4b UTSW 17 34,959,999 (GRCm39) missense probably benign
R1645:C4b UTSW 17 34,959,571 (GRCm39) missense probably damaging 1.00
R1664:C4b UTSW 17 34,951,952 (GRCm39) missense probably damaging 1.00
R1678:C4b UTSW 17 34,962,624 (GRCm39) missense probably benign 0.05
R1710:C4b UTSW 17 34,962,638 (GRCm39) splice site probably benign
R1713:C4b UTSW 17 34,948,245 (GRCm39) splice site probably benign
R1770:C4b UTSW 17 34,955,901 (GRCm39) missense possibly damaging 0.78
R1859:C4b UTSW 17 34,954,527 (GRCm39) missense probably benign
R1924:C4b UTSW 17 34,948,631 (GRCm39) missense probably damaging 1.00
R2057:C4b UTSW 17 34,947,594 (GRCm39) missense probably damaging 1.00
R2060:C4b UTSW 17 34,955,075 (GRCm39) missense probably damaging 1.00
R2184:C4b UTSW 17 34,956,676 (GRCm39) missense probably benign 0.27
R2306:C4b UTSW 17 34,947,492 (GRCm39) missense probably benign 0.00
R2363:C4b UTSW 17 34,955,032 (GRCm39) splice site probably benign
R2365:C4b UTSW 17 34,955,032 (GRCm39) splice site probably benign
R2379:C4b UTSW 17 34,954,717 (GRCm39) missense possibly damaging 0.81
R2860:C4b UTSW 17 34,953,732 (GRCm39) missense probably damaging 0.99
R2861:C4b UTSW 17 34,953,732 (GRCm39) missense probably damaging 0.99
R3551:C4b UTSW 17 34,960,846 (GRCm39) missense possibly damaging 0.75
R3765:C4b UTSW 17 34,948,814 (GRCm39) missense probably damaging 0.98
R4157:C4b UTSW 17 34,961,829 (GRCm39) missense probably damaging 1.00
R4299:C4b UTSW 17 34,950,118 (GRCm39) missense possibly damaging 0.52
R4365:C4b UTSW 17 34,953,717 (GRCm39) missense possibly damaging 0.65
R4411:C4b UTSW 17 34,947,838 (GRCm39) missense probably damaging 1.00
R4613:C4b UTSW 17 34,953,525 (GRCm39) missense probably benign 0.12
R4784:C4b UTSW 17 34,952,380 (GRCm39) missense probably benign 0.00
R4790:C4b UTSW 17 34,953,117 (GRCm39) missense probably benign 0.01
R4831:C4b UTSW 17 34,955,864 (GRCm39) splice site probably null
R4879:C4b UTSW 17 34,962,621 (GRCm39) missense probably damaging 0.99
R5036:C4b UTSW 17 34,959,419 (GRCm39) critical splice acceptor site probably null
R5361:C4b UTSW 17 34,960,212 (GRCm39) missense probably benign 0.15
R5384:C4b UTSW 17 34,956,635 (GRCm39) missense possibly damaging 0.89
R5518:C4b UTSW 17 34,953,416 (GRCm39) missense probably benign 0.00
R5590:C4b UTSW 17 34,959,309 (GRCm39) missense probably damaging 0.98
R5643:C4b UTSW 17 34,961,391 (GRCm39) missense probably benign 0.01
R5644:C4b UTSW 17 34,961,391 (GRCm39) missense probably benign 0.01
R5833:C4b UTSW 17 34,949,647 (GRCm39) missense probably damaging 1.00
R5931:C4b UTSW 17 34,948,167 (GRCm39) missense probably damaging 0.99
R6178:C4b UTSW 17 34,952,380 (GRCm39) missense probably benign 0.00
R6209:C4b UTSW 17 34,960,061 (GRCm39) missense possibly damaging 0.93
R6225:C4b UTSW 17 34,957,848 (GRCm39) missense possibly damaging 0.64
R6518:C4b UTSW 17 34,953,179 (GRCm39) missense probably damaging 0.98
R6613:C4b UTSW 17 34,952,539 (GRCm39) missense probably damaging 0.99
R6781:C4b UTSW 17 34,961,928 (GRCm39) missense probably damaging 0.99
R6807:C4b UTSW 17 34,949,930 (GRCm39) missense probably benign 0.17
R6858:C4b UTSW 17 34,948,805 (GRCm39) missense probably damaging 1.00
R6962:C4b UTSW 17 34,951,140 (GRCm39) splice site probably null
R7068:C4b UTSW 17 34,952,451 (GRCm39) missense probably damaging 1.00
R7081:C4b UTSW 17 34,954,417 (GRCm39) missense probably benign 0.27
R7105:C4b UTSW 17 34,949,885 (GRCm39) missense possibly damaging 0.52
R7211:C4b UTSW 17 34,954,508 (GRCm39) missense possibly damaging 0.92
R7296:C4b UTSW 17 34,962,633 (GRCm39) missense probably damaging 1.00
R7314:C4b UTSW 17 34,959,330 (GRCm39) missense probably benign
R7330:C4b UTSW 17 34,949,446 (GRCm39) missense probably damaging 1.00
R7397:C4b UTSW 17 34,961,364 (GRCm39) missense possibly damaging 0.80
R7437:C4b UTSW 17 34,953,707 (GRCm39) missense probably benign 0.10
R7490:C4b UTSW 17 34,950,054 (GRCm39) nonsense probably null
R7597:C4b UTSW 17 34,958,649 (GRCm39) missense probably benign
R7633:C4b UTSW 17 34,948,373 (GRCm39) critical splice donor site probably null
R7900:C4b UTSW 17 34,958,751 (GRCm39) missense probably benign 0.03
R7910:C4b UTSW 17 34,959,326 (GRCm39) missense probably benign 0.00
R7923:C4b UTSW 17 34,961,354 (GRCm39) missense probably damaging 1.00
R7960:C4b UTSW 17 34,960,252 (GRCm39) splice site probably null
R8420:C4b UTSW 17 34,953,513 (GRCm39) missense probably damaging 0.97
R8467:C4b UTSW 17 34,951,787 (GRCm39) missense possibly damaging 0.51
R8558:C4b UTSW 17 34,955,541 (GRCm39) missense probably damaging 1.00
R8725:C4b UTSW 17 34,953,459 (GRCm39) missense probably damaging 1.00
R8727:C4b UTSW 17 34,953,459 (GRCm39) missense probably damaging 1.00
R8853:C4b UTSW 17 34,948,879 (GRCm39) missense possibly damaging 0.91
R8934:C4b UTSW 17 34,951,958 (GRCm39) missense possibly damaging 0.78
R8944:C4b UTSW 17 34,961,913 (GRCm39) missense probably benign 0.00
R8960:C4b UTSW 17 34,952,892 (GRCm39) missense probably damaging 1.00
R8982:C4b UTSW 17 34,953,338 (GRCm39) critical splice donor site probably null
R9104:C4b UTSW 17 34,948,233 (GRCm39) missense probably benign 0.39
R9114:C4b UTSW 17 34,948,404 (GRCm39) missense probably damaging 0.99
R9348:C4b UTSW 17 34,952,159 (GRCm39) missense probably benign 0.01
R9428:C4b UTSW 17 34,949,885 (GRCm39) missense possibly damaging 0.52
R9533:C4b UTSW 17 34,956,698 (GRCm39) nonsense probably null
R9591:C4b UTSW 17 34,957,929 (GRCm39) missense probably benign 0.00
R9678:C4b UTSW 17 34,960,763 (GRCm39) critical splice donor site probably null
Z1176:C4b UTSW 17 34,950,121 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGCTGATGGTCCACCAACACAGAG -3'
(R):5'- AGTCCTTGACATTCAACAGAGCACC -3'

Sequencing Primer
(F):5'- GACCCATAGCCATGATCTGG -3'
(R):5'- CACAGAACTTCGACTCTTGGTAG -3'
Posted On 2014-04-13