Incidental Mutation 'R1496:Setbp1'
ID168913
Institutional Source Beutler Lab
Gene Symbol Setbp1
Ensembl Gene ENSMUSG00000024548
Gene NameSET binding protein 1
SynonymsSeb
MMRRC Submission 039547-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.607) question?
Stock #R1496 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location78750380-79109391 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 78859912 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 180 (K180T)
Ref Sequence ENSEMBL: ENSMUSP00000025430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025430]
Predicted Effect probably damaging
Transcript: ENSMUST00000025430
AA Change: K180T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025430
Gene: ENSMUSG00000024548
AA Change: K180T

DomainStartEndE-ValueType
low complexity region 155 165 N/A INTRINSIC
low complexity region 221 251 N/A INTRINSIC
low complexity region 278 286 N/A INTRINSIC
AT_hook 528 540 4.64e-1 SMART
low complexity region 565 571 N/A INTRINSIC
low complexity region 594 617 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
AT_hook 960 972 1.89e-1 SMART
low complexity region 1086 1103 N/A INTRINSIC
low complexity region 1316 1337 N/A INTRINSIC
AT_hook 1393 1405 7.27e-1 SMART
low complexity region 1462 1486 N/A INTRINSIC
low complexity region 1498 1514 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161465
AA Change: K180T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124497
Gene: ENSMUSG00000024548
AA Change: K180T

DomainStartEndE-ValueType
low complexity region 46 55 N/A INTRINSIC
low complexity region 202 212 N/A INTRINSIC
low complexity region 268 298 N/A INTRINSIC
low complexity region 325 333 N/A INTRINSIC
AT_hook 575 587 4.64e-1 SMART
low complexity region 612 618 N/A INTRINSIC
low complexity region 641 664 N/A INTRINSIC
low complexity region 925 934 N/A INTRINSIC
AT_hook 1007 1019 1.89e-1 SMART
low complexity region 1133 1150 N/A INTRINSIC
low complexity region 1363 1384 N/A INTRINSIC
AT_hook 1440 1452 7.27e-1 SMART
low complexity region 1509 1533 N/A INTRINSIC
low complexity region 1545 1561 N/A INTRINSIC
Meta Mutation Damage Score 0.0865 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.9%
Validation Efficiency 98% (94/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a several motifs including a ski homology region and a SET-binding region in addition to three nuclear localization signals. The encoded protein has been shown to bind the SET nuclear oncogene which is involved in DNA replication. Mutations in this gene are associated with Schinzel-Giedion midface retraction syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A G 9: 46,310,254 probably benign Het
4933411K16Rik T C 19: 42,053,050 Y207H probably damaging Het
Abcc1 T A 16: 14,448,434 L832Q probably damaging Het
Acan T A 7: 79,100,804 H1774Q probably benign Het
Adss T C 1: 177,772,194 T275A probably benign Het
Ano5 G A 7: 51,583,775 R595H probably damaging Het
Araf G T X: 20,859,704 R522L probably damaging Het
Arhgef28 C T 13: 97,965,546 V807I possibly damaging Het
Bin1 T C 18: 32,412,704 I103T probably damaging Het
C4b C T 17: 34,740,021 R478Q probably benign Het
Cacna1b G A 2: 24,678,035 P1015S probably benign Het
Capn1 A G 19: 6,007,498 probably null Het
Cep290 A G 10: 100,538,966 Q1358R probably damaging Het
Cfap126 T C 1: 171,125,817 probably benign Het
Chn1 T C 2: 73,679,607 probably benign Het
Cldn8 T C 16: 88,562,401 E212G probably benign Het
Cpb1 T C 3: 20,263,532 N249S probably damaging Het
Cxcr6 A T 9: 123,810,347 I138F probably benign Het
Dab2ip G A 2: 35,718,791 R579H probably damaging Het
Dcaf8 T C 1: 172,193,855 M538T probably benign Het
Dhrs4 T G 14: 55,487,650 L201V probably damaging Het
Dnah12 C T 14: 26,710,248 A407V probably benign Het
Elavl3 T A 9: 22,026,165 probably benign Het
Elp4 T C 2: 105,832,161 H88R probably benign Het
Ercc3 T C 18: 32,261,297 probably benign Het
Eri1 A G 8: 35,469,181 S329P possibly damaging Het
Erich2 A T 2: 70,512,773 probably benign Het
Esyt1 A G 10: 128,512,428 S864P possibly damaging Het
Fam170b A G 14: 32,835,631 E141G probably damaging Het
Fat1 A G 8: 45,033,390 Y3304C probably damaging Het
Fbn1 T C 2: 125,309,495 T2531A probably benign Het
Fgfr3 T C 5: 33,729,750 V166A probably damaging Het
Glt8d2 T C 10: 82,659,538 D194G probably damaging Het
Gpr89 A G 3: 96,905,210 I5T probably benign Het
Gpx6 A T 13: 21,318,920 H168L probably benign Het
Gusb T C 5: 129,998,544 T307A probably benign Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Ifngr1 A G 10: 19,601,445 D118G probably benign Het
Ipcef1 A T 10: 6,935,173 probably null Het
Kbtbd3 A T 9: 4,330,276 T217S probably benign Het
Kmt5a GAA GA 5: 124,459,885 probably null Het
Lrp1 T C 10: 127,539,011 D4526G probably damaging Het
Lrp1b A T 2: 42,323,662 V46D probably damaging Het
Lsm8 T A 6: 18,849,659 M22K probably benign Het
Map1lc3b C T 8: 121,596,600 R70C possibly damaging Het
Meiob T A 17: 24,813,052 S14T possibly damaging Het
Mkx G T 18: 6,992,330 Y183* probably null Het
Mrs2 T C 13: 25,005,034 Y99C probably benign Het
Mycbpap T C 11: 94,505,561 K151R probably benign Het
Neb T G 2: 52,328,734 Q88P probably damaging Het
Noc4l T A 5: 110,650,078 H319L probably damaging Het
Nt5c2 G A 19: 46,904,978 T122I probably damaging Het
Nuggc A T 14: 65,624,133 N476I probably damaging Het
Obscn T A 11: 59,031,036 H5978L probably benign Het
Oc90 G T 15: 65,876,521 A412D probably damaging Het
Olfr1080 A T 2: 86,553,752 V124E probably damaging Het
Olfr1143 T G 2: 87,802,868 S160A probably benign Het
Olfr1249 A G 2: 89,630,014 S295P possibly damaging Het
Olfr168 T A 16: 19,530,383 D179V possibly damaging Het
Olfr399 A G 11: 74,053,824 *312Q probably null Het
Olfr8 T A 10: 78,955,848 S214R probably benign Het
Pdzrn3 A T 6: 101,150,969 V912E probably benign Het
Phactr1 T A 13: 43,094,990 Y387N probably damaging Het
Picalm T A 7: 90,130,651 C27S probably benign Het
Pkd1l1 T A 11: 8,941,077 I314F possibly damaging Het
Pold2 T C 11: 5,874,175 E210G possibly damaging Het
Ptprz1 C T 6: 23,049,524 probably benign Het
Rac1 G T 5: 143,507,338 A165E probably damaging Het
Rpap3 G T 15: 97,686,483 T360K possibly damaging Het
Scn9a G A 2: 66,526,888 T1012I probably benign Het
Sdad1 A G 5: 92,309,823 I20T possibly damaging Het
Sgpl1 T C 10: 61,102,589 N475S probably damaging Het
Shroom3 T C 5: 92,942,834 S1148P possibly damaging Het
Sin3a T A 9: 57,119,158 H1119Q possibly damaging Het
Slc26a7 T A 4: 14,506,489 Y620F probably benign Het
Slc4a1 T C 11: 102,361,171 I36V probably benign Het
Smarca2 C G 19: 26,631,101 P263A possibly damaging Het
Sp100 T C 1: 85,663,521 probably benign Het
Spag6l A G 16: 16,780,614 probably benign Het
Sptbn1 T C 11: 30,121,498 N1491S probably damaging Het
Tbl1xr1 T G 3: 22,190,951 V155G possibly damaging Het
Tmc1 A G 19: 20,868,355 I168T probably damaging Het
Tmem87b G A 2: 128,826,393 probably null Het
Tnfrsf9 T A 4: 150,933,104 probably null Het
Tnni3k T C 3: 154,939,658 D530G probably damaging Het
Vmn1r209 G A 13: 22,805,764 S252F probably damaging Het
Zbtb3 A T 19: 8,803,350 N109I probably damaging Het
Zdhhc17 T G 10: 110,946,210 H541P probably damaging Het
Zfp84 A G 7: 29,776,614 I244V possibly damaging Het
Zyx A G 6: 42,356,312 Y393C probably damaging Het
Other mutations in Setbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Setbp1 APN 18 78755679 nonsense probably null 0.00
IGL00668:Setbp1 APN 18 78857770 missense probably damaging 1.00
IGL01628:Setbp1 APN 18 78856777 missense probably damaging 1.00
IGL02084:Setbp1 APN 18 78857410 missense probably damaging 1.00
IGL02405:Setbp1 APN 18 78857299 missense probably damaging 1.00
IGL02427:Setbp1 APN 18 78857473 missense probably damaging 1.00
IGL02612:Setbp1 APN 18 78755710 missense probably damaging 1.00
IGL02725:Setbp1 APN 18 78857374 nonsense probably null
IGL03005:Setbp1 APN 18 78859125 missense possibly damaging 0.75
IGL03123:Setbp1 APN 18 78857009 missense probably damaging 1.00
R1083:Setbp1 UTSW 18 78857626 missense probably damaging 1.00
R1110:Setbp1 UTSW 18 78857860 missense probably damaging 1.00
R1167:Setbp1 UTSW 18 78857236 missense possibly damaging 0.85
R1221:Setbp1 UTSW 18 78856583 missense probably damaging 1.00
R1225:Setbp1 UTSW 18 78858208 missense probably damaging 0.99
R1327:Setbp1 UTSW 18 78783358 missense probably benign 0.00
R1481:Setbp1 UTSW 18 78783301 missense probably benign 0.01
R1482:Setbp1 UTSW 18 79086835 missense probably damaging 1.00
R1550:Setbp1 UTSW 18 78858592 missense probably damaging 1.00
R1708:Setbp1 UTSW 18 78858467 missense probably damaging 0.99
R1751:Setbp1 UTSW 18 78857398 missense probably damaging 1.00
R1922:Setbp1 UTSW 18 78858362 missense possibly damaging 0.75
R1986:Setbp1 UTSW 18 78858544 missense probably damaging 0.99
R2090:Setbp1 UTSW 18 78856720 missense probably benign 0.00
R2851:Setbp1 UTSW 18 78923996 missense probably benign 0.11
R2853:Setbp1 UTSW 18 78923996 missense probably benign 0.11
R2941:Setbp1 UTSW 18 78858197 missense probably damaging 1.00
R3151:Setbp1 UTSW 18 78857435 missense probably damaging 1.00
R3156:Setbp1 UTSW 18 78859303 missense probably benign 0.00
R3807:Setbp1 UTSW 18 78783322 missense probably benign 0.01
R4133:Setbp1 UTSW 18 78856991 missense probably benign 0.05
R4287:Setbp1 UTSW 18 78859061 missense probably benign 0.03
R4345:Setbp1 UTSW 18 79086579 missense probably damaging 0.99
R4374:Setbp1 UTSW 18 78859922 missense probably damaging 0.97
R4377:Setbp1 UTSW 18 78859922 missense probably damaging 0.97
R4378:Setbp1 UTSW 18 78856618 missense possibly damaging 0.95
R4379:Setbp1 UTSW 18 79086681 missense probably damaging 1.00
R4585:Setbp1 UTSW 18 79086949 missense probably benign 0.00
R4595:Setbp1 UTSW 18 78857516 missense probably benign 0.00
R4817:Setbp1 UTSW 18 78858800 missense probably damaging 1.00
R4971:Setbp1 UTSW 18 78858167 missense probably benign 0.07
R4976:Setbp1 UTSW 18 79086712 missense probably damaging 1.00
R5017:Setbp1 UTSW 18 78856594 missense possibly damaging 0.81
R5066:Setbp1 UTSW 18 78857299 missense probably damaging 1.00
R5133:Setbp1 UTSW 18 78857482 missense probably damaging 1.00
R5151:Setbp1 UTSW 18 78857999 missense probably damaging 1.00
R5237:Setbp1 UTSW 18 78856975 missense possibly damaging 0.92
R5480:Setbp1 UTSW 18 78858063 missense probably damaging 0.99
R5507:Setbp1 UTSW 18 79086712 missense probably damaging 1.00
R5529:Setbp1 UTSW 18 79086652 missense probably damaging 0.99
R5622:Setbp1 UTSW 18 78857485 missense probably damaging 1.00
R5722:Setbp1 UTSW 18 78856645 missense possibly damaging 0.95
R5806:Setbp1 UTSW 18 78856482 unclassified probably null
R5940:Setbp1 UTSW 18 78755488 missense probably damaging 1.00
R6025:Setbp1 UTSW 18 78859240 missense probably damaging 0.98
R6030:Setbp1 UTSW 18 78857711 missense probably benign 0.02
R6030:Setbp1 UTSW 18 78857711 missense probably benign 0.02
R6250:Setbp1 UTSW 18 78858002 missense probably benign 0.00
R6256:Setbp1 UTSW 18 78857257 missense probably damaging 1.00
R6332:Setbp1 UTSW 18 78783369 missense probably benign 0.21
R6522:Setbp1 UTSW 18 78857390 missense probably damaging 0.98
R6873:Setbp1 UTSW 18 78859559 missense probably benign 0.00
R6886:Setbp1 UTSW 18 78857500 missense probably damaging 1.00
R6986:Setbp1 UTSW 18 78857839 missense probably damaging 1.00
R7042:Setbp1 UTSW 18 79086855 missense probably damaging 1.00
R7131:Setbp1 UTSW 18 79086960 missense probably benign 0.08
R7134:Setbp1 UTSW 18 78859519 missense possibly damaging 0.86
R7215:Setbp1 UTSW 18 78856837 missense probably damaging 0.97
R7219:Setbp1 UTSW 18 78755745 missense probably damaging 1.00
R7378:Setbp1 UTSW 18 78857486 missense probably damaging 1.00
R7461:Setbp1 UTSW 18 78856492 missense probably benign 0.06
R7589:Setbp1 UTSW 18 78856492 missense probably benign 0.01
Z1088:Setbp1 UTSW 18 78859594 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTTTGCTACTGCTGGACAACTGAC -3'
(R):5'- GGGGCAGCAATTAAAGCATCCTTG -3'

Sequencing Primer
(F):5'- TTCAAGAGCTGGGACCTTGC -3'
(R):5'- CCTTGCTAATGTCCAAATTCAGTG -3'
Posted On2014-04-13