Mutagenetix > Incidental Mutation

Incidental Mutation 'R1497:Casp8ap2'

168942

Institutional Source

Beutler Lab

Gene Symbol

Casp8ap2

Ensembl Gene

ENSMUSG00000028282

Gene Name

caspase 8 associated protein 2

Synonyms

FLASH, D4Ertd659e

MMRRC Submission

039548-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1497 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32615451-32653265 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 32639938 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 331 (S331P)

Ref Sequence

ENSEMBL: ENSMUSP00000136016 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029950] [ENSMUST00000108178] [ENSMUST00000178925]

AlphaFold

Q9WUF3

Predicted Effect

probably benign
Transcript: ENSMUST00000029950
AA Change: S331P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000029950
Gene: ENSMUSG00000028282
AA Change: S331P

Domain	Start	End	E-Value	Type
coiled coil region	68	142	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	458	477	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1250	1268	N/A	INTRINSIC
low complexity region	1360	1377	N/A	INTRINSIC
low complexity region	1458	1470	N/A	INTRINSIC
low complexity region	1477	1498	N/A	INTRINSIC
low complexity region	1882	1895	N/A	INTRINSIC
PDB:2LR8\|A	1896	1962	1e-31	PDB
Blast:SANT	1905	1955	2e-21	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000108178

SMART Domains

Protein: ENSMUSP00000103813
Gene: ENSMUSG00000028282

Domain	Start	End	E-Value	Type
PDB:2LR8\|A	126	190	4e-26	PDB
Blast:SANT	139	183	4e-19	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127619

Predicted Effect

probably benign
Transcript: ENSMUST00000178925
AA Change: S331P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000136016
Gene: ENSMUSG00000028282
AA Change: S331P

Domain	Start	End	E-Value	Type
coiled coil region	68	142	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	458	477	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1250	1268	N/A	INTRINSIC
low complexity region	1360	1377	N/A	INTRINSIC
low complexity region	1458	1470	N/A	INTRINSIC
low complexity region	1477	1498	N/A	INTRINSIC
low complexity region	1882	1895	N/A	INTRINSIC
PDB:2LR8\|A	1896	1962	1e-31	PDB
Blast:SANT	1905	1955	2e-21	BLAST

Meta Mutation Damage Score

0.0594

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.8%
20x: 94.4%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is highly similar to FLASH, a mouse apoptotic protein identified by its interaction with the death-effector domain (DED) of caspase 8. Studies of FLASH protein suggested that this protein may be a component of the death-inducing signaling complex that includes Fas receptor, Fas-binding adapter FADD, and caspase 8, and plays a regulatory role in Fas-mediated apoptosis. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die before implantation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	G	T	11: 109,973,821		probably benign	Het
Abhd17a	A	G	10: 80,584,330		probably benign	Het
Acacb	G	A	5: 114,196,807	E646K	probably damaging	Het
Afap1l2	T	C	19: 56,928,311	M262V	probably benign	Het
Anapc7	T	A	5: 122,435,515		probably benign	Het
Car5b	T	A	X: 163,988,404	K188N	probably benign	Het
Caskin1	C	T	17: 24,504,541	R768*	probably null	Het
Ccdc68	C	T	18: 69,960,514		probably benign	Het
Cd44	A	T	2: 102,842,955		probably null	Het
Celsr3	A	G	9: 108,848,865	S3090G	probably benign	Het
Clasp1	A	T	1: 118,552,058	M1023L	probably benign	Het
Clec16a	T	C	16: 10,635,259	F608S	probably damaging	Het
Col7a1	A	C	9: 108,978,825	E2531A	unknown	Het
Ctc1	T	A	11: 69,022,561	C128S	probably benign	Het
Cyp2d41-ps	T	C	15: 82,782,022		noncoding transcript	Het
Cyp2j6	T	A	4: 96,531,661	I278F	probably damaging	Het
Dhtkd1	A	T	2: 5,904,113	S723R	probably damaging	Het
Dhx8	A	G	11: 101,735,387		probably benign	Het
Dnah17	A	T	11: 118,114,233	L775Q	probably damaging	Het
Dnah8	C	A	17: 30,752,075	T2701K	probably damaging	Het
Eml3	T	A	19: 8,936,369	S424R	probably damaging	Het
Epm2aip1	A	G	9: 111,272,247	E96G	possibly damaging	Het
Ezr	T	C	17: 6,742,708	H314R	probably benign	Het
Fam193b	G	T	13: 55,554,434	H43Q	probably damaging	Het
Fam208b	T	C	13: 3,570,409	E2164G	probably damaging	Het
Fam217a	T	A	13: 34,911,212	N340I	probably damaging	Het
Fcrl1	A	T	3: 87,384,802	Q89H	probably damaging	Het
Flg2	A	T	3: 93,219,769	H1996L	unknown	Het
Gabpb1	C	T	2: 126,639,249	V327M	possibly damaging	Het
Gtf3c3	A	G	1: 54,437,939	V36A	probably benign	Het
Hspg2	A	G	4: 137,548,096	N2739S	probably damaging	Het
Hyal1	A	G	9: 107,577,995		probably null	Het
Ipo13	T	C	4: 117,904,659	D448G	probably benign	Het
Kcnq5	T	C	1: 21,402,386	D860G	possibly damaging	Het
Kif13b	A	G	14: 64,736,266	N355S	probably damaging	Het
Kmt2c	T	A	5: 25,314,515	H2199L	possibly damaging	Het
Magi1	A	G	6: 93,747,329	F235S	probably damaging	Het
Maml1	A	C	11: 50,265,707	M547R	possibly damaging	Het
Mapk7	T	C	11: 61,493,863	K6E	possibly damaging	Het
Mbd5	T	A	2: 49,257,381	N534K	possibly damaging	Het
Mcat	G	A	15: 83,549,252	Q34*	probably null	Het
Mcu	T	A	10: 59,448,848	D180V	probably damaging	Het
Mettl21c	G	T	1: 44,009,791	P199T	probably benign	Het
Mndal	A	T	1: 173,872,875	S177T	probably benign	Het
Mpeg1	G	T	19: 12,461,247	C23F	probably benign	Het
Mup15	T	A	4: 61,438,234	Y98F	probably benign	Het
Myh8	T	C	11: 67,289,812	S625P	probably benign	Het
Nipsnap2	T	C	5: 129,753,218		probably benign	Het
Nlrp4e	T	C	7: 23,320,372	S95P	probably benign	Het
Olfr1196	T	C	2: 88,700,762	D189G	probably damaging	Het
Olfr378	T	A	11: 73,425,827	D52V	possibly damaging	Het
Otop2	A	G	11: 115,329,849		probably null	Het
Pcnx4	G	C	12: 72,574,400	G998A	probably benign	Het
Pnkd	C	A	1: 74,351,522		probably null	Het
Ppp4r4	T	A	12: 103,606,945	V701E	probably benign	Het
Ryr2	A	G	13: 11,601,841	I3897T	probably damaging	Het
Scn1a	T	C	2: 66,332,287	E205G	probably damaging	Het
Sdk2	G	A	11: 113,893,575		probably benign	Het
Serpinb5	A	T	1: 106,876,052	Q156L	probably benign	Het
Setdb1	A	T	3: 95,327,467	V975D	probably benign	Het
Shc1	A	G	3: 89,428,445	*470W	probably null	Het
Sik3	T	A	9: 46,202,022	V587E	probably damaging	Het
Sik3	C	A	9: 46,221,089	H1276Q	probably benign	Het
Spata7	T	C	12: 98,668,861	I384T	probably damaging	Het
Tanc2	T	A	11: 105,922,137	V1469D	probably benign	Het
Tdrd5	A	T	1: 156,255,802	N888K	probably benign	Het
Tex22	T	C	12: 113,075,380	S34P	probably benign	Het
Tmed6	T	C	8: 107,064,122	T98A	probably benign	Het
Trim66	G	A	7: 109,484,619	P141L	probably benign	Het
Trpa1	T	C	1: 14,885,812	I778V	probably benign	Het
Urb2	T	A	8: 124,028,077	H174Q	probably damaging	Het
Usb1	T	C	8: 95,338,697	V59A	probably benign	Het
Vmn1r11	T	A	6: 57,137,409	N19K	probably damaging	Het
Vmn1r185	A	T	7: 26,611,794	F95L	probably benign	Het
Vmn1r206	C	T	13: 22,620,990	V16M	probably benign	Het
Vmn2r92	T	C	17: 18,167,363	V210A	probably benign	Het
Wdr17	A	T	8: 54,672,501	I448K	possibly damaging	Het
Zfp768	T	A	7: 127,343,561	Q465L	probably damaging	Het
Zfp804b	T	A	5: 6,771,105	N617Y	probably damaging	Het

Other mutations in Casp8ap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00686:Casp8ap2	APN	4	32641433	missense	probably damaging	1.00
IGL00714:Casp8ap2	APN	4	32649192	missense	probably damaging	1.00
IGL00754:Casp8ap2	APN	4	32641036	missense	probably benign	0.00
IGL00954:Casp8ap2	APN	4	32645403	missense	probably damaging	1.00
IGL00970:Casp8ap2	APN	4	32646182	missense	probably benign
IGL01534:Casp8ap2	APN	4	32648134	splice site	probably benign
IGL01596:Casp8ap2	APN	4	32646365	missense	probably damaging	1.00
IGL01686:Casp8ap2	APN	4	32641294	missense	possibly damaging	0.94
IGL02002:Casp8ap2	APN	4	32639391	missense	probably damaging	1.00
IGL02273:Casp8ap2	APN	4	32643974	missense	probably damaging	1.00
IGL02510:Casp8ap2	APN	4	32639704	missense	probably benign	0.05
IGL02600:Casp8ap2	APN	4	32630246	missense	probably null	1.00
IGL02929:Casp8ap2	APN	4	32624105	utr 5 prime	probably benign
F5770:Casp8ap2	UTSW	4	32639944	missense	probably benign	0.00
IGL02988:Casp8ap2	UTSW	4	32644590	missense	probably benign	0.14
R0023:Casp8ap2	UTSW	4	32640185	missense	probably damaging	0.99
R0027:Casp8ap2	UTSW	4	32643810	missense	probably benign	0.01
R0090:Casp8ap2	UTSW	4	32640327	missense	probably damaging	1.00
R0117:Casp8ap2	UTSW	4	32640817	missense	probably benign	0.00
R0144:Casp8ap2	UTSW	4	32643797	missense	possibly damaging	0.50
R0268:Casp8ap2	UTSW	4	32644079	missense	probably damaging	0.99
R0344:Casp8ap2	UTSW	4	32644079	missense	probably damaging	0.99
R0555:Casp8ap2	UTSW	4	32640381	missense	probably damaging	1.00
R1051:Casp8ap2	UTSW	4	32640790	missense	probably benign	0.28
R1165:Casp8ap2	UTSW	4	32640563	missense	probably benign	0.01
R1243:Casp8ap2	UTSW	4	32645687	missense	probably benign	0.03
R1311:Casp8ap2	UTSW	4	32648111	missense	probably damaging	0.98
R1337:Casp8ap2	UTSW	4	32645721	missense	possibly damaging	0.64
R1471:Casp8ap2	UTSW	4	32639386	nonsense	probably null
R1521:Casp8ap2	UTSW	4	32631867	missense	probably damaging	1.00
R1588:Casp8ap2	UTSW	4	32640541	missense	probably benign	0.00
R1625:Casp8ap2	UTSW	4	32648068	missense	probably benign	0.04
R1731:Casp8ap2	UTSW	4	32641442	missense	possibly damaging	0.94
R1899:Casp8ap2	UTSW	4	32643647	missense	probably damaging	0.98
R2000:Casp8ap2	UTSW	4	32634874	missense	probably damaging	1.00
R2021:Casp8ap2	UTSW	4	32644560	missense	probably benign	0.05
R2022:Casp8ap2	UTSW	4	32644560	missense	probably benign	0.05
R2023:Casp8ap2	UTSW	4	32644560	missense	probably benign	0.05
R2088:Casp8ap2	UTSW	4	32631126	missense	probably damaging	1.00
R2104:Casp8ap2	UTSW	4	32644727	missense	probably benign	0.00
R2128:Casp8ap2	UTSW	4	32640142	missense	probably benign	0.06
R2129:Casp8ap2	UTSW	4	32640142	missense	probably benign	0.06
R2305:Casp8ap2	UTSW	4	32646411	missense	probably damaging	1.00
R2316:Casp8ap2	UTSW	4	32643781	missense	probably benign	0.31
R2919:Casp8ap2	UTSW	4	32645343	missense	probably damaging	1.00
R4091:Casp8ap2	UTSW	4	32643611	missense	probably damaging	1.00
R4357:Casp8ap2	UTSW	4	32646150	missense	probably benign	0.00
R4807:Casp8ap2	UTSW	4	32644505	missense	possibly damaging	0.89
R4828:Casp8ap2	UTSW	4	32639807	missense	probably benign
R4908:Casp8ap2	UTSW	4	32639905	missense	possibly damaging	0.90
R4945:Casp8ap2	UTSW	4	32631163	missense	possibly damaging	0.57
R4962:Casp8ap2	UTSW	4	32640554	missense	probably damaging	0.99
R6014:Casp8ap2	UTSW	4	32641400	missense	probably damaging	0.97
R6092:Casp8ap2	UTSW	4	32639380	missense	probably damaging	1.00
R6257:Casp8ap2	UTSW	4	32641364	missense	possibly damaging	0.94
R6289:Casp8ap2	UTSW	4	32639590	missense	probably damaging	1.00
R6482:Casp8ap2	UTSW	4	32634813	missense	probably damaging	1.00
R6496:Casp8ap2	UTSW	4	32641553	missense	probably benign	0.05
R6515:Casp8ap2	UTSW	4	32646423	missense	possibly damaging	0.64
R7015:Casp8ap2	UTSW	4	32644278	missense	probably damaging	1.00
R7033:Casp8ap2	UTSW	4	32639392	missense	probably damaging	1.00
R7072:Casp8ap2	UTSW	4	32644766	missense	probably damaging	1.00
R7448:Casp8ap2	UTSW	4	32643974	missense	possibly damaging	0.84
R7944:Casp8ap2	UTSW	4	32645909	missense	probably benign	0.12
R7945:Casp8ap2	UTSW	4	32645909	missense	probably benign	0.12
R8170:Casp8ap2	UTSW	4	32615490	splice site	probably benign
R8179:Casp8ap2	UTSW	4	32643939	nonsense	probably null
R8207:Casp8ap2	UTSW	4	32646446	missense	possibly damaging	0.63
R8263:Casp8ap2	UTSW	4	32644072	missense	probably damaging	1.00
R8298:Casp8ap2	UTSW	4	32640429	missense	probably benign	0.30
R9441:Casp8ap2	UTSW	4	32645873	missense	probably benign	0.00
R9455:Casp8ap2	UTSW	4	32643924	missense	possibly damaging	0.85
R9729:Casp8ap2	UTSW	4	32643807	missense	possibly damaging	0.71
V7580:Casp8ap2	UTSW	4	32639944	missense	probably benign	0.00
X0018:Casp8ap2	UTSW	4	32643738	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TGGCACTAGACATAGCCAGTGTAGC -3'
(R):5'- TGAAAGCCATGACTGTTCATCCCTC -3'

Sequencing Primer
(F):5'- AGCTGTAATGACAGTGAGCC -3'
(R):5'- GAAGCCGTAATGTTTCACGTC -3'

Posted On

2014-04-13