Mutagenetix > Incidental Mutation

Incidental Mutation 'R1497:Acacb'

168950

Institutional Source

Beutler Lab

Gene Symbol

Acacb

Ensembl Gene

ENSMUSG00000042010

Gene Name

acetyl-Coenzyme A carboxylase beta

Synonyms

Acc2, Accb

MMRRC Submission

039548-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1497 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

114146535-114250761 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 114196807 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 646 (E646K)

Ref Sequence

ENSEMBL: ENSMUSP00000099642 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]

AlphaFold

E9Q4Z2

Predicted Effect

probably damaging
Transcript: ENSMUST00000031583
AA Change: E646K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: E646K

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	2.1e-32	PFAM
Pfam:CPSase_L_D2	405	606	3.3e-52	PFAM
Pfam:ATP-grasp_4	413	576	2.1e-9	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	1.9e-17	PFAM
Pfam:ACC_central	952	1678	2.2e-290	PFAM
Pfam:Carboxyl_trans	1770	2324	2.3e-181	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000102582
AA Change: E646K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: E646K

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	8.2e-29	PFAM
Pfam:CPSase_L_D2	405	606	3.8e-52	PFAM
Pfam:ATP-grasp_4	409	576	1.4e-12	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	9.1e-17	PFAM
Pfam:ACC_central	952	1678	2.3e-250	PFAM
Pfam:Carboxyl_trans	1770	2324	4.8e-172	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143276

Meta Mutation Damage Score

0.7397

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.8%
20x: 94.4%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	G	T	11: 109,973,821		probably benign	Het
Abhd17a	A	G	10: 80,584,330		probably benign	Het
Afap1l2	T	C	19: 56,928,311	M262V	probably benign	Het
Anapc7	T	A	5: 122,435,515		probably benign	Het
Car5b	T	A	X: 163,988,404	K188N	probably benign	Het
Caskin1	C	T	17: 24,504,541	R768*	probably null	Het
Casp8ap2	T	C	4: 32,639,938	S331P	probably benign	Het
Ccdc68	C	T	18: 69,960,514		probably benign	Het
Cd44	A	T	2: 102,842,955		probably null	Het
Celsr3	A	G	9: 108,848,865	S3090G	probably benign	Het
Clasp1	A	T	1: 118,552,058	M1023L	probably benign	Het
Clec16a	T	C	16: 10,635,259	F608S	probably damaging	Het
Col7a1	A	C	9: 108,978,825	E2531A	unknown	Het
Ctc1	T	A	11: 69,022,561	C128S	probably benign	Het
Cyp2d41-ps	T	C	15: 82,782,022		noncoding transcript	Het
Cyp2j6	T	A	4: 96,531,661	I278F	probably damaging	Het
Dhtkd1	A	T	2: 5,904,113	S723R	probably damaging	Het
Dhx8	A	G	11: 101,735,387		probably benign	Het
Dnah17	A	T	11: 118,114,233	L775Q	probably damaging	Het
Dnah8	C	A	17: 30,752,075	T2701K	probably damaging	Het
Eml3	T	A	19: 8,936,369	S424R	probably damaging	Het
Epm2aip1	A	G	9: 111,272,247	E96G	possibly damaging	Het
Ezr	T	C	17: 6,742,708	H314R	probably benign	Het
Fam193b	G	T	13: 55,554,434	H43Q	probably damaging	Het
Fam208b	T	C	13: 3,570,409	E2164G	probably damaging	Het
Fam217a	T	A	13: 34,911,212	N340I	probably damaging	Het
Fcrl1	A	T	3: 87,384,802	Q89H	probably damaging	Het
Flg2	A	T	3: 93,219,769	H1996L	unknown	Het
Gabpb1	C	T	2: 126,639,249	V327M	possibly damaging	Het
Gtf3c3	A	G	1: 54,437,939	V36A	probably benign	Het
Hspg2	A	G	4: 137,548,096	N2739S	probably damaging	Het
Hyal1	A	G	9: 107,577,995		probably null	Het
Ipo13	T	C	4: 117,904,659	D448G	probably benign	Het
Kcnq5	T	C	1: 21,402,386	D860G	possibly damaging	Het
Kif13b	A	G	14: 64,736,266	N355S	probably damaging	Het
Kmt2c	T	A	5: 25,314,515	H2199L	possibly damaging	Het
Magi1	A	G	6: 93,747,329	F235S	probably damaging	Het
Maml1	A	C	11: 50,265,707	M547R	possibly damaging	Het
Mapk7	T	C	11: 61,493,863	K6E	possibly damaging	Het
Mbd5	T	A	2: 49,257,381	N534K	possibly damaging	Het
Mcat	G	A	15: 83,549,252	Q34*	probably null	Het
Mcu	T	A	10: 59,448,848	D180V	probably damaging	Het
Mettl21c	G	T	1: 44,009,791	P199T	probably benign	Het
Mndal	A	T	1: 173,872,875	S177T	probably benign	Het
Mpeg1	G	T	19: 12,461,247	C23F	probably benign	Het
Mup15	T	A	4: 61,438,234	Y98F	probably benign	Het
Myh8	T	C	11: 67,289,812	S625P	probably benign	Het
Nipsnap2	T	C	5: 129,753,218		probably benign	Het
Nlrp4e	T	C	7: 23,320,372	S95P	probably benign	Het
Olfr1196	T	C	2: 88,700,762	D189G	probably damaging	Het
Olfr378	T	A	11: 73,425,827	D52V	possibly damaging	Het
Otop2	A	G	11: 115,329,849		probably null	Het
Pcnx4	G	C	12: 72,574,400	G998A	probably benign	Het
Pnkd	C	A	1: 74,351,522		probably null	Het
Ppp4r4	T	A	12: 103,606,945	V701E	probably benign	Het
Ryr2	A	G	13: 11,601,841	I3897T	probably damaging	Het
Scn1a	T	C	2: 66,332,287	E205G	probably damaging	Het
Sdk2	G	A	11: 113,893,575		probably benign	Het
Serpinb5	A	T	1: 106,876,052	Q156L	probably benign	Het
Setdb1	A	T	3: 95,327,467	V975D	probably benign	Het
Shc1	A	G	3: 89,428,445	*470W	probably null	Het
Sik3	T	A	9: 46,202,022	V587E	probably damaging	Het
Sik3	C	A	9: 46,221,089	H1276Q	probably benign	Het
Spata7	T	C	12: 98,668,861	I384T	probably damaging	Het
Tanc2	T	A	11: 105,922,137	V1469D	probably benign	Het
Tdrd5	A	T	1: 156,255,802	N888K	probably benign	Het
Tex22	T	C	12: 113,075,380	S34P	probably benign	Het
Tmed6	T	C	8: 107,064,122	T98A	probably benign	Het
Trim66	G	A	7: 109,484,619	P141L	probably benign	Het
Trpa1	T	C	1: 14,885,812	I778V	probably benign	Het
Urb2	T	A	8: 124,028,077	H174Q	probably damaging	Het
Usb1	T	C	8: 95,338,697	V59A	probably benign	Het
Vmn1r11	T	A	6: 57,137,409	N19K	probably damaging	Het
Vmn1r185	A	T	7: 26,611,794	F95L	probably benign	Het
Vmn1r206	C	T	13: 22,620,990	V16M	probably benign	Het
Vmn2r92	T	C	17: 18,167,363	V210A	probably benign	Het
Wdr17	A	T	8: 54,672,501	I448K	possibly damaging	Het
Zfp768	T	A	7: 127,343,561	Q465L	probably damaging	Het
Zfp804b	T	A	5: 6,771,105	N617Y	probably damaging	Het

Other mutations in Acacb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Acacb	APN	5	114200289	missense	probably damaging	1.00
IGL01291:Acacb	APN	5	114225870	missense	probably benign	0.03
IGL01301:Acacb	APN	5	114246498	missense	probably benign
IGL01633:Acacb	APN	5	114218858	splice site	probably benign
IGL01736:Acacb	APN	5	114188442	missense	possibly damaging	0.96
IGL01782:Acacb	APN	5	114200520	missense	probably damaging	1.00
IGL01924:Acacb	APN	5	114223986	splice site	probably benign
IGL01933:Acacb	APN	5	114184190	splice site	probably benign
IGL02028:Acacb	APN	5	114166015	missense	probably damaging	1.00
IGL02045:Acacb	APN	5	114240660	missense	possibly damaging	0.95
IGL02346:Acacb	APN	5	114238699	missense	probably damaging	1.00
IGL02421:Acacb	APN	5	114223878	missense	probably benign	0.00
IGL02445:Acacb	APN	5	114245137	missense	probably damaging	1.00
IGL02491:Acacb	APN	5	114192105	missense	probably damaging	1.00
IGL02598:Acacb	APN	5	114246037	missense	probably damaging	1.00
IGL02700:Acacb	APN	5	114218881	missense	probably damaging	1.00
IGL02730:Acacb	APN	5	114166149	splice site	probably benign
IGL03110:Acacb	APN	5	114195234	missense	probably damaging	0.96
IGL03125:Acacb	APN	5	114204805	missense	possibly damaging	0.49
IGL03263:Acacb	APN	5	114213693	missense	probably damaging	1.00
IGL03324:Acacb	APN	5	114225854	nonsense	probably null
acetone	UTSW	5	114226857	nonsense	probably null
anabolism	UTSW	5	114245220	missense	possibly damaging	0.63
ANU05:Acacb	UTSW	5	114225870	missense	probably benign	0.03
ANU18:Acacb	UTSW	5	114246498	missense	probably benign
BB001:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
BB011:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
I0000:Acacb	UTSW	5	114238655	missense	probably damaging	0.99
R0001:Acacb	UTSW	5	114204833	splice site	probably benign
R0219:Acacb	UTSW	5	114232944	missense	possibly damaging	0.79
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0278:Acacb	UTSW	5	114233259	nonsense	probably null
R0607:Acacb	UTSW	5	114200301	missense	probably damaging	1.00
R0964:Acacb	UTSW	5	114229752	missense	possibly damaging	0.64
R1116:Acacb	UTSW	5	114210956	missense	probably damaging	1.00
R1196:Acacb	UTSW	5	114245092	missense	probably benign	0.00
R1204:Acacb	UTSW	5	114190153	missense	probably damaging	1.00
R1387:Acacb	UTSW	5	114200512	missense	probably benign
R1415:Acacb	UTSW	5	114165921	missense	probably benign
R1475:Acacb	UTSW	5	114195252	missense	possibly damaging	0.87
R1520:Acacb	UTSW	5	114201940	missense	possibly damaging	0.67
R1591:Acacb	UTSW	5	114203423	missense	possibly damaging	0.87
R1644:Acacb	UTSW	5	114195285	missense	probably damaging	1.00
R1732:Acacb	UTSW	5	114190087	missense	possibly damaging	0.63
R1783:Acacb	UTSW	5	114209767	frame shift	probably null
R1784:Acacb	UTSW	5	114209767	frame shift	probably null
R1834:Acacb	UTSW	5	114235475	missense	probably damaging	1.00
R1858:Acacb	UTSW	5	114196709	missense	probably benign	0.13
R1886:Acacb	UTSW	5	114218959	missense	probably damaging	1.00
R1901:Acacb	UTSW	5	114165734	nonsense	probably null
R1902:Acacb	UTSW	5	114165734	nonsense	probably null
R1903:Acacb	UTSW	5	114165734	nonsense	probably null
R1924:Acacb	UTSW	5	114230720	missense	possibly damaging	0.67
R1934:Acacb	UTSW	5	114198282	missense	probably benign	0.27
R2051:Acacb	UTSW	5	114245890	missense	probably damaging	1.00
R2132:Acacb	UTSW	5	114209767	frame shift	probably null
R2133:Acacb	UTSW	5	114209767	frame shift	probably null
R2260:Acacb	UTSW	5	114216917	missense	probably damaging	0.99
R2967:Acacb	UTSW	5	114166070	missense	possibly damaging	0.81
R3421:Acacb	UTSW	5	114212636	splice site	probably null
R3729:Acacb	UTSW	5	114207348	missense	probably damaging	0.99
R4206:Acacb	UTSW	5	114213651	missense	probably benign
R4245:Acacb	UTSW	5	114230784	missense	probably damaging	0.97
R4386:Acacb	UTSW	5	114241921	critical splice acceptor site	probably null
R4439:Acacb	UTSW	5	114246496	missense	possibly damaging	0.50
R4577:Acacb	UTSW	5	114226831	missense	probably damaging	1.00
R4658:Acacb	UTSW	5	114200564	missense	probably damaging	0.96
R4688:Acacb	UTSW	5	114204763	missense	probably benign	0.01
R4720:Acacb	UTSW	5	114229914	missense	possibly damaging	0.73
R4898:Acacb	UTSW	5	114232938	missense	probably benign	0.04
R5044:Acacb	UTSW	5	114166027	missense	probably benign	0.03
R5070:Acacb	UTSW	5	114246028	missense	possibly damaging	0.46
R5294:Acacb	UTSW	5	114241952	missense	probably damaging	1.00
R5350:Acacb	UTSW	5	114244551	missense	probably damaging	1.00
R5401:Acacb	UTSW	5	114209853	missense	possibly damaging	0.80
R5531:Acacb	UTSW	5	114204706	missense	possibly damaging	0.92
R5542:Acacb	UTSW	5	114195737	missense	probably damaging	1.00
R5751:Acacb	UTSW	5	114230832	missense	possibly damaging	0.79
R5821:Acacb	UTSW	5	114184106	missense	possibly damaging	0.69
R5893:Acacb	UTSW	5	114229851	missense	probably benign	0.01
R5911:Acacb	UTSW	5	114232890	missense	probably damaging	0.97
R5944:Acacb	UTSW	5	114245980	missense	probably damaging	1.00
R5973:Acacb	UTSW	5	114226867	missense	probably damaging	1.00
R6027:Acacb	UTSW	5	114165600	missense	probably benign	0.43
R6103:Acacb	UTSW	5	114245881	missense	probably damaging	1.00
R6139:Acacb	UTSW	5	114212652	missense	probably damaging	1.00
R6292:Acacb	UTSW	5	114200251	missense	probably damaging	1.00
R6368:Acacb	UTSW	5	114216823	missense	probably damaging	0.98
R6429:Acacb	UTSW	5	114228591	missense	probably damaging	1.00
R6942:Acacb	UTSW	5	114191963	critical splice donor site	probably null
R7138:Acacb	UTSW	5	114207326	missense	probably benign	0.12
R7241:Acacb	UTSW	5	114245100	missense	possibly damaging	0.94
R7254:Acacb	UTSW	5	114209751	critical splice acceptor site	probably null
R7396:Acacb	UTSW	5	114213661	missense	possibly damaging	0.87
R7439:Acacb	UTSW	5	114195642	missense	possibly damaging	0.84
R7484:Acacb	UTSW	5	114218862	missense	probably damaging	1.00
R7585:Acacb	UTSW	5	114246012	missense	probably damaging	0.99
R7712:Acacb	UTSW	5	114165738	missense	probably benign	0.13
R7868:Acacb	UTSW	5	114248227	missense	probably benign	0.22
R7873:Acacb	UTSW	5	114223278	missense	possibly damaging	0.88
R7924:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
R7940:Acacb	UTSW	5	114166047	missense	possibly damaging	0.77
R7951:Acacb	UTSW	5	114188340	missense	probably damaging	1.00
R7960:Acacb	UTSW	5	114230861	missense	probably benign	0.00
R7972:Acacb	UTSW	5	114226857	nonsense	probably null
R8007:Acacb	UTSW	5	114218874	missense	probably damaging	0.97
R8022:Acacb	UTSW	5	114223854	missense	probably benign
R8030:Acacb	UTSW	5	114233167	missense	probably damaging	1.00
R8241:Acacb	UTSW	5	114195236	missense	possibly damaging	0.49
R8264:Acacb	UTSW	5	114207366	missense	probably benign	0.00
R8292:Acacb	UTSW	5	114200494	critical splice acceptor site	probably null
R8678:Acacb	UTSW	5	114201971	nonsense	probably null
R8693:Acacb	UTSW	5	114226783	missense	probably damaging	0.99
R8697:Acacb	UTSW	5	114213380	missense	probably damaging	0.96
R8772:Acacb	UTSW	5	114184118	missense	possibly damaging	0.73
R8918:Acacb	UTSW	5	114195254	missense	probably damaging	1.00
R9008:Acacb	UTSW	5	114248754	splice site	silent
R9044:Acacb	UTSW	5	114235517	missense	probably benign	0.00
R9165:Acacb	UTSW	5	114216683	missense	probably benign	0.01
R9231:Acacb	UTSW	5	114211092	missense	probably benign	0.01
R9440:Acacb	UTSW	5	114246024	missense	possibly damaging	0.56
R9444:Acacb	UTSW	5	114245959	missense	probably damaging	0.99
R9562:Acacb	UTSW	5	114233336	missense	probably damaging	0.99
R9794:Acacb	UTSW	5	114249517	missense	probably benign	0.00
V1662:Acacb	UTSW	5	114238708	missense	probably damaging	1.00
Z1176:Acacb	UTSW	5	114248948	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CCTAGCACACTAACCTGTGCGATG -3'
(R):5'- AACTTGGGCTCCAAACCTGGCTAC -3'

Sequencing Primer
(F):5'- GATGGGTTCTTCCTTAGATCGCC -3'
(R):5'- TGGGAGGGCTTACCTGAC -3'

Posted On

2014-04-13