Incidental Mutation 'R1497:Acacb'
ID 168950
Institutional Source Beutler Lab
Gene Symbol Acacb
Ensembl Gene ENSMUSG00000042010
Gene Name acetyl-Coenzyme A carboxylase beta
Synonyms Acc2, Accb
MMRRC Submission 039548-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1497 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 114284748-114388822 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 114334868 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 646 (E646K)
Ref Sequence ENSEMBL: ENSMUSP00000099642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]
AlphaFold E9Q4Z2
Predicted Effect probably damaging
Transcript: ENSMUST00000031583
AA Change: E646K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: E646K

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 2.1e-32 PFAM
Pfam:CPSase_L_D2 405 606 3.3e-52 PFAM
Pfam:ATP-grasp_4 413 576 2.1e-9 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 1.9e-17 PFAM
Pfam:ACC_central 952 1678 2.2e-290 PFAM
Pfam:Carboxyl_trans 1770 2324 2.3e-181 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102582
AA Change: E646K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: E646K

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 8.2e-29 PFAM
Pfam:CPSase_L_D2 405 606 3.8e-52 PFAM
Pfam:ATP-grasp_4 409 576 1.4e-12 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 9.1e-17 PFAM
Pfam:ACC_central 952 1678 2.3e-250 PFAM
Pfam:Carboxyl_trans 1770 2324 4.8e-172 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143276
Meta Mutation Damage Score 0.7397 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G T 11: 109,864,647 (GRCm39) probably benign Het
Abhd17a A G 10: 80,420,164 (GRCm39) probably benign Het
Afap1l2 T C 19: 56,916,743 (GRCm39) M262V probably benign Het
Anapc7 T A 5: 122,573,578 (GRCm39) probably benign Het
Car5b T A X: 162,771,400 (GRCm39) K188N probably benign Het
Caskin1 C T 17: 24,723,515 (GRCm39) R768* probably null Het
Casp8ap2 T C 4: 32,639,938 (GRCm39) S331P probably benign Het
Ccdc68 C T 18: 70,093,585 (GRCm39) probably benign Het
Cd44 A T 2: 102,673,300 (GRCm39) probably null Het
Celsr3 A G 9: 108,726,064 (GRCm39) S3090G probably benign Het
Clasp1 A T 1: 118,479,788 (GRCm39) M1023L probably benign Het
Clec16a T C 16: 10,453,123 (GRCm39) F608S probably damaging Het
Col7a1 A C 9: 108,807,893 (GRCm39) E2531A unknown Het
Ctc1 T A 11: 68,913,387 (GRCm39) C128S probably benign Het
Cyp2d41-ps T C 15: 82,666,223 (GRCm39) noncoding transcript Het
Cyp2j6 T A 4: 96,419,898 (GRCm39) I278F probably damaging Het
Dhtkd1 A T 2: 5,908,924 (GRCm39) S723R probably damaging Het
Dhx8 A G 11: 101,626,213 (GRCm39) probably benign Het
Dnah17 A T 11: 118,005,059 (GRCm39) L775Q probably damaging Het
Dnah8 C A 17: 30,971,049 (GRCm39) T2701K probably damaging Het
Eml3 T A 19: 8,913,733 (GRCm39) S424R probably damaging Het
Epm2aip1 A G 9: 111,101,315 (GRCm39) E96G possibly damaging Het
Ezr T C 17: 7,010,107 (GRCm39) H314R probably benign Het
Fam193b G T 13: 55,702,247 (GRCm39) H43Q probably damaging Het
Fam217a T A 13: 35,095,195 (GRCm39) N340I probably damaging Het
Fcrl1 A T 3: 87,292,109 (GRCm39) Q89H probably damaging Het
Flg2 A T 3: 93,127,076 (GRCm39) H1996L unknown Het
Gabpb1 C T 2: 126,481,169 (GRCm39) V327M possibly damaging Het
Gtf3c3 A G 1: 54,477,098 (GRCm39) V36A probably benign Het
Hspg2 A G 4: 137,275,407 (GRCm39) N2739S probably damaging Het
Hyal1 A G 9: 107,455,194 (GRCm39) probably null Het
Ipo13 T C 4: 117,761,856 (GRCm39) D448G probably benign Het
Kcnq5 T C 1: 21,472,610 (GRCm39) D860G possibly damaging Het
Kif13b A G 14: 64,973,715 (GRCm39) N355S probably damaging Het
Kmt2c T A 5: 25,519,513 (GRCm39) H2199L possibly damaging Het
Magi1 A G 6: 93,724,310 (GRCm39) F235S probably damaging Het
Maml1 A C 11: 50,156,534 (GRCm39) M547R possibly damaging Het
Mapk7 T C 11: 61,384,689 (GRCm39) K6E possibly damaging Het
Mbd5 T A 2: 49,147,393 (GRCm39) N534K possibly damaging Het
Mcat G A 15: 83,433,453 (GRCm39) Q34* probably null Het
Mcu T A 10: 59,284,670 (GRCm39) D180V probably damaging Het
Mettl21c G T 1: 44,048,951 (GRCm39) P199T probably benign Het
Mndal A T 1: 173,700,441 (GRCm39) S177T probably benign Het
Mpeg1 G T 19: 12,438,611 (GRCm39) C23F probably benign Het
Mup15 T A 4: 61,356,471 (GRCm39) Y98F probably benign Het
Myh8 T C 11: 67,180,638 (GRCm39) S625P probably benign Het
Nipsnap2 T C 5: 129,830,282 (GRCm39) probably benign Het
Nlrp4e T C 7: 23,019,797 (GRCm39) S95P probably benign Het
Or1e19 T A 11: 73,316,653 (GRCm39) D52V possibly damaging Het
Or4a66 T C 2: 88,531,106 (GRCm39) D189G probably damaging Het
Otop2 A G 11: 115,220,675 (GRCm39) probably null Het
Pcnx4 G C 12: 72,621,174 (GRCm39) G998A probably benign Het
Pnkd C A 1: 74,390,681 (GRCm39) probably null Het
Ppp4r4 T A 12: 103,573,204 (GRCm39) V701E probably benign Het
Ryr2 A G 13: 11,616,727 (GRCm39) I3897T probably damaging Het
Scn1a T C 2: 66,162,631 (GRCm39) E205G probably damaging Het
Sdk2 G A 11: 113,784,401 (GRCm39) probably benign Het
Serpinb5 A T 1: 106,803,782 (GRCm39) Q156L probably benign Het
Setdb1 A T 3: 95,234,778 (GRCm39) V975D probably benign Het
Shc1 A G 3: 89,335,752 (GRCm39) *470W probably null Het
Sik3 T A 9: 46,113,320 (GRCm39) V587E probably damaging Het
Sik3 C A 9: 46,132,387 (GRCm39) H1276Q probably benign Het
Spata7 T C 12: 98,635,120 (GRCm39) I384T probably damaging Het
Tanc2 T A 11: 105,812,963 (GRCm39) V1469D probably benign Het
Tasor2 T C 13: 3,620,409 (GRCm39) E2164G probably damaging Het
Tdrd5 A T 1: 156,083,372 (GRCm39) N888K probably benign Het
Tex22 T C 12: 113,039,000 (GRCm39) S34P probably benign Het
Tmed6 T C 8: 107,790,754 (GRCm39) T98A probably benign Het
Trim66 G A 7: 109,083,826 (GRCm39) P141L probably benign Het
Trpa1 T C 1: 14,956,036 (GRCm39) I778V probably benign Het
Urb2 T A 8: 124,754,816 (GRCm39) H174Q probably damaging Het
Usb1 T C 8: 96,065,325 (GRCm39) V59A probably benign Het
Vmn1r11 T A 6: 57,114,394 (GRCm39) N19K probably damaging Het
Vmn1r185 A T 7: 26,311,219 (GRCm39) F95L probably benign Het
Vmn1r206 C T 13: 22,805,160 (GRCm39) V16M probably benign Het
Vmn2r92 T C 17: 18,387,625 (GRCm39) V210A probably benign Het
Wdr17 A T 8: 55,125,536 (GRCm39) I448K possibly damaging Het
Zfp768 T A 7: 126,942,733 (GRCm39) Q465L probably damaging Het
Zfp804b T A 5: 6,821,105 (GRCm39) N617Y probably damaging Het
Other mutations in Acacb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Acacb APN 5 114,338,350 (GRCm39) missense probably damaging 1.00
IGL01291:Acacb APN 5 114,363,931 (GRCm39) missense probably benign 0.03
IGL01301:Acacb APN 5 114,384,559 (GRCm39) missense probably benign
IGL01633:Acacb APN 5 114,356,919 (GRCm39) splice site probably benign
IGL01736:Acacb APN 5 114,326,503 (GRCm39) missense possibly damaging 0.96
IGL01782:Acacb APN 5 114,338,581 (GRCm39) missense probably damaging 1.00
IGL01924:Acacb APN 5 114,362,047 (GRCm39) splice site probably benign
IGL01933:Acacb APN 5 114,322,251 (GRCm39) splice site probably benign
IGL02028:Acacb APN 5 114,304,076 (GRCm39) missense probably damaging 1.00
IGL02045:Acacb APN 5 114,378,721 (GRCm39) missense possibly damaging 0.95
IGL02346:Acacb APN 5 114,376,760 (GRCm39) missense probably damaging 1.00
IGL02421:Acacb APN 5 114,361,939 (GRCm39) missense probably benign 0.00
IGL02445:Acacb APN 5 114,383,198 (GRCm39) missense probably damaging 1.00
IGL02491:Acacb APN 5 114,330,166 (GRCm39) missense probably damaging 1.00
IGL02598:Acacb APN 5 114,384,098 (GRCm39) missense probably damaging 1.00
IGL02700:Acacb APN 5 114,356,942 (GRCm39) missense probably damaging 1.00
IGL02730:Acacb APN 5 114,304,210 (GRCm39) splice site probably benign
IGL03110:Acacb APN 5 114,333,295 (GRCm39) missense probably damaging 0.96
IGL03125:Acacb APN 5 114,342,866 (GRCm39) missense possibly damaging 0.49
IGL03263:Acacb APN 5 114,351,754 (GRCm39) missense probably damaging 1.00
IGL03324:Acacb APN 5 114,363,915 (GRCm39) nonsense probably null
acetone UTSW 5 114,364,918 (GRCm39) nonsense probably null
anabolism UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
ANU05:Acacb UTSW 5 114,363,931 (GRCm39) missense probably benign 0.03
ANU18:Acacb UTSW 5 114,384,559 (GRCm39) missense probably benign
BB001:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
BB011:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
I0000:Acacb UTSW 5 114,376,716 (GRCm39) missense probably damaging 0.99
R0001:Acacb UTSW 5 114,342,894 (GRCm39) splice site probably benign
R0219:Acacb UTSW 5 114,371,005 (GRCm39) missense possibly damaging 0.79
R0234:Acacb UTSW 5 114,347,878 (GRCm39) missense probably damaging 0.99
R0234:Acacb UTSW 5 114,347,878 (GRCm39) missense probably damaging 0.99
R0278:Acacb UTSW 5 114,371,320 (GRCm39) nonsense probably null
R0607:Acacb UTSW 5 114,338,362 (GRCm39) missense probably damaging 1.00
R0964:Acacb UTSW 5 114,367,813 (GRCm39) missense possibly damaging 0.64
R1116:Acacb UTSW 5 114,349,017 (GRCm39) missense probably damaging 1.00
R1196:Acacb UTSW 5 114,383,153 (GRCm39) missense probably benign 0.00
R1204:Acacb UTSW 5 114,328,214 (GRCm39) missense probably damaging 1.00
R1387:Acacb UTSW 5 114,338,573 (GRCm39) missense probably benign
R1415:Acacb UTSW 5 114,303,982 (GRCm39) missense probably benign
R1475:Acacb UTSW 5 114,333,313 (GRCm39) missense possibly damaging 0.87
R1520:Acacb UTSW 5 114,340,001 (GRCm39) missense possibly damaging 0.67
R1591:Acacb UTSW 5 114,341,484 (GRCm39) missense possibly damaging 0.87
R1644:Acacb UTSW 5 114,333,346 (GRCm39) missense probably damaging 1.00
R1732:Acacb UTSW 5 114,328,148 (GRCm39) missense possibly damaging 0.63
R1783:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R1784:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R1834:Acacb UTSW 5 114,373,536 (GRCm39) missense probably damaging 1.00
R1858:Acacb UTSW 5 114,334,770 (GRCm39) missense probably benign 0.13
R1886:Acacb UTSW 5 114,357,020 (GRCm39) missense probably damaging 1.00
R1901:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1902:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1903:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1924:Acacb UTSW 5 114,368,781 (GRCm39) missense possibly damaging 0.67
R1934:Acacb UTSW 5 114,336,343 (GRCm39) missense probably benign 0.27
R2051:Acacb UTSW 5 114,383,951 (GRCm39) missense probably damaging 1.00
R2132:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R2133:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R2260:Acacb UTSW 5 114,354,978 (GRCm39) missense probably damaging 0.99
R2967:Acacb UTSW 5 114,304,131 (GRCm39) missense possibly damaging 0.81
R3421:Acacb UTSW 5 114,350,697 (GRCm39) splice site probably null
R3729:Acacb UTSW 5 114,345,409 (GRCm39) missense probably damaging 0.99
R4206:Acacb UTSW 5 114,351,712 (GRCm39) missense probably benign
R4245:Acacb UTSW 5 114,368,845 (GRCm39) missense probably damaging 0.97
R4386:Acacb UTSW 5 114,379,982 (GRCm39) critical splice acceptor site probably null
R4439:Acacb UTSW 5 114,384,557 (GRCm39) missense possibly damaging 0.50
R4577:Acacb UTSW 5 114,364,892 (GRCm39) missense probably damaging 1.00
R4658:Acacb UTSW 5 114,338,625 (GRCm39) missense probably damaging 0.96
R4688:Acacb UTSW 5 114,342,824 (GRCm39) missense probably benign 0.01
R4720:Acacb UTSW 5 114,367,975 (GRCm39) missense possibly damaging 0.73
R4898:Acacb UTSW 5 114,370,999 (GRCm39) missense probably benign 0.04
R5044:Acacb UTSW 5 114,304,088 (GRCm39) missense probably benign 0.03
R5070:Acacb UTSW 5 114,384,089 (GRCm39) missense possibly damaging 0.46
R5294:Acacb UTSW 5 114,380,013 (GRCm39) missense probably damaging 1.00
R5350:Acacb UTSW 5 114,382,612 (GRCm39) missense probably damaging 1.00
R5401:Acacb UTSW 5 114,347,914 (GRCm39) missense possibly damaging 0.80
R5531:Acacb UTSW 5 114,342,767 (GRCm39) missense possibly damaging 0.92
R5542:Acacb UTSW 5 114,333,798 (GRCm39) missense probably damaging 1.00
R5751:Acacb UTSW 5 114,368,893 (GRCm39) missense possibly damaging 0.79
R5821:Acacb UTSW 5 114,322,167 (GRCm39) missense possibly damaging 0.69
R5893:Acacb UTSW 5 114,367,912 (GRCm39) missense probably benign 0.01
R5911:Acacb UTSW 5 114,370,951 (GRCm39) missense probably damaging 0.97
R5944:Acacb UTSW 5 114,384,041 (GRCm39) missense probably damaging 1.00
R5973:Acacb UTSW 5 114,364,928 (GRCm39) missense probably damaging 1.00
R6027:Acacb UTSW 5 114,303,661 (GRCm39) missense probably benign 0.43
R6103:Acacb UTSW 5 114,383,942 (GRCm39) missense probably damaging 1.00
R6139:Acacb UTSW 5 114,350,713 (GRCm39) missense probably damaging 1.00
R6292:Acacb UTSW 5 114,338,312 (GRCm39) missense probably damaging 1.00
R6368:Acacb UTSW 5 114,354,884 (GRCm39) missense probably damaging 0.98
R6429:Acacb UTSW 5 114,366,652 (GRCm39) missense probably damaging 1.00
R6942:Acacb UTSW 5 114,330,024 (GRCm39) critical splice donor site probably null
R7138:Acacb UTSW 5 114,345,387 (GRCm39) missense probably benign 0.12
R7241:Acacb UTSW 5 114,383,161 (GRCm39) missense possibly damaging 0.94
R7254:Acacb UTSW 5 114,347,812 (GRCm39) critical splice acceptor site probably null
R7396:Acacb UTSW 5 114,351,722 (GRCm39) missense possibly damaging 0.87
R7439:Acacb UTSW 5 114,333,703 (GRCm39) missense possibly damaging 0.84
R7484:Acacb UTSW 5 114,356,923 (GRCm39) missense probably damaging 1.00
R7585:Acacb UTSW 5 114,384,073 (GRCm39) missense probably damaging 0.99
R7712:Acacb UTSW 5 114,303,799 (GRCm39) missense probably benign 0.13
R7868:Acacb UTSW 5 114,386,288 (GRCm39) missense probably benign 0.22
R7873:Acacb UTSW 5 114,361,339 (GRCm39) missense possibly damaging 0.88
R7924:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
R7940:Acacb UTSW 5 114,304,108 (GRCm39) missense possibly damaging 0.77
R7951:Acacb UTSW 5 114,326,401 (GRCm39) missense probably damaging 1.00
R7960:Acacb UTSW 5 114,368,922 (GRCm39) missense probably benign 0.00
R7972:Acacb UTSW 5 114,364,918 (GRCm39) nonsense probably null
R8007:Acacb UTSW 5 114,356,935 (GRCm39) missense probably damaging 0.97
R8022:Acacb UTSW 5 114,361,915 (GRCm39) missense probably benign
R8030:Acacb UTSW 5 114,371,228 (GRCm39) missense probably damaging 1.00
R8241:Acacb UTSW 5 114,333,297 (GRCm39) missense possibly damaging 0.49
R8264:Acacb UTSW 5 114,345,427 (GRCm39) missense probably benign 0.00
R8292:Acacb UTSW 5 114,338,555 (GRCm39) critical splice acceptor site probably null
R8678:Acacb UTSW 5 114,340,032 (GRCm39) nonsense probably null
R8693:Acacb UTSW 5 114,364,844 (GRCm39) missense probably damaging 0.99
R8697:Acacb UTSW 5 114,351,441 (GRCm39) missense probably damaging 0.96
R8772:Acacb UTSW 5 114,322,179 (GRCm39) missense possibly damaging 0.73
R8918:Acacb UTSW 5 114,333,315 (GRCm39) missense probably damaging 1.00
R9008:Acacb UTSW 5 114,386,815 (GRCm39) splice site silent
R9044:Acacb UTSW 5 114,373,578 (GRCm39) missense probably benign 0.00
R9165:Acacb UTSW 5 114,354,744 (GRCm39) missense probably benign 0.01
R9231:Acacb UTSW 5 114,349,153 (GRCm39) missense probably benign 0.01
R9440:Acacb UTSW 5 114,384,085 (GRCm39) missense possibly damaging 0.56
R9444:Acacb UTSW 5 114,384,020 (GRCm39) missense probably damaging 0.99
R9562:Acacb UTSW 5 114,371,397 (GRCm39) missense probably damaging 0.99
R9794:Acacb UTSW 5 114,387,578 (GRCm39) missense probably benign 0.00
V1662:Acacb UTSW 5 114,376,769 (GRCm39) missense probably damaging 1.00
Z1176:Acacb UTSW 5 114,387,009 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCTAGCACACTAACCTGTGCGATG -3'
(R):5'- AACTTGGGCTCCAAACCTGGCTAC -3'

Sequencing Primer
(F):5'- GATGGGTTCTTCCTTAGATCGCC -3'
(R):5'- TGGGAGGGCTTACCTGAC -3'
Posted On 2014-04-13