Incidental Mutation 'R1497:Sdk2'
ID168983
Institutional Source Beutler Lab
Gene Symbol Sdk2
Ensembl Gene ENSMUSG00000041592
Gene Namesidekick cell adhesion molecule 2
Synonyms5330435L01Rik, 4632412F08Rik
MMRRC Submission 039548-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R1497 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location113776374-114067046 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 113893575 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041627] [ENSMUST00000141943]
Predicted Effect probably benign
Transcript: ENSMUST00000041627
SMART Domains Protein: ENSMUSP00000038972
Gene: ENSMUSG00000041592

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 43 102 4.67e-4 SMART
IG 123 208 6.07e-3 SMART
IG 225 309 1.4e-7 SMART
IGc2 325 391 6.21e-9 SMART
IGc2 418 486 8.57e-12 SMART
IG 506 591 2.37e-5 SMART
FN3 594 678 1.91e-7 SMART
FN3 694 780 2.42e-9 SMART
FN3 796 884 3.45e-5 SMART
FN3 899 981 2.36e-12 SMART
FN3 997 1084 1.64e-6 SMART
FN3 1101 1188 8.83e-12 SMART
FN3 1204 1289 3.62e-8 SMART
FN3 1305 1388 1.74e-10 SMART
FN3 1404 1489 8.23e-12 SMART
FN3 1506 1612 3.62e-8 SMART
FN3 1628 1713 1.15e-10 SMART
FN3 1728 1815 2.17e-11 SMART
FN3 1829 1913 5.04e-7 SMART
transmembrane domain 1935 1957 N/A INTRINSIC
low complexity region 2138 2153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141943
SMART Domains Protein: ENSMUSP00000116872
Gene: ENSMUSG00000041592

DomainStartEndE-ValueType
IGc2 43 102 4.67e-4 SMART
IG 123 208 6.07e-3 SMART
IG 225 309 1.4e-7 SMART
IGc2 325 391 6.21e-9 SMART
IGc2 418 486 8.57e-12 SMART
IG 506 591 2.37e-5 SMART
FN3 594 678 1.91e-7 SMART
FN3 694 780 2.42e-9 SMART
FN3 796 889 1.96e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155651
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired interconnectvity between VG3 amacrine cells and W3B retinal ganglion cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b G T 11: 109,973,821 probably benign Het
Abhd17a A G 10: 80,584,330 probably benign Het
Acacb G A 5: 114,196,807 E646K probably damaging Het
Afap1l2 T C 19: 56,928,311 M262V probably benign Het
Anapc7 T A 5: 122,435,515 probably benign Het
Car5b T A X: 163,988,404 K188N probably benign Het
Caskin1 C T 17: 24,504,541 R768* probably null Het
Casp8ap2 T C 4: 32,639,938 S331P probably benign Het
Ccdc68 C T 18: 69,960,514 probably benign Het
Cd44 A T 2: 102,842,955 probably null Het
Celsr3 A G 9: 108,848,865 S3090G probably benign Het
Clasp1 A T 1: 118,552,058 M1023L probably benign Het
Clec16a T C 16: 10,635,259 F608S probably damaging Het
Col7a1 A C 9: 108,978,825 E2531A unknown Het
Ctc1 T A 11: 69,022,561 C128S probably benign Het
Cyp2d41-ps T C 15: 82,782,022 noncoding transcript Het
Cyp2j6 T A 4: 96,531,661 I278F probably damaging Het
Dhtkd1 A T 2: 5,904,113 S723R probably damaging Het
Dhx8 A G 11: 101,735,387 probably benign Het
Dnah17 A T 11: 118,114,233 L775Q probably damaging Het
Dnah8 C A 17: 30,752,075 T2701K probably damaging Het
Eml3 T A 19: 8,936,369 S424R probably damaging Het
Epm2aip1 A G 9: 111,272,247 E96G possibly damaging Het
Ezr T C 17: 6,742,708 H314R probably benign Het
Fam193b G T 13: 55,554,434 H43Q probably damaging Het
Fam208b T C 13: 3,570,409 E2164G probably damaging Het
Fam217a T A 13: 34,911,212 N340I probably damaging Het
Fcrl1 A T 3: 87,384,802 Q89H probably damaging Het
Flg2 A T 3: 93,219,769 H1996L unknown Het
Gabpb1 C T 2: 126,639,249 V327M possibly damaging Het
Gtf3c3 A G 1: 54,437,939 V36A probably benign Het
Hspg2 A G 4: 137,548,096 N2739S probably damaging Het
Hyal1 A G 9: 107,577,995 probably null Het
Ipo13 T C 4: 117,904,659 D448G probably benign Het
Kcnq5 T C 1: 21,402,386 D860G possibly damaging Het
Kif13b A G 14: 64,736,266 N355S probably damaging Het
Kmt2c T A 5: 25,314,515 H2199L possibly damaging Het
Magi1 A G 6: 93,747,329 F235S probably damaging Het
Maml1 A C 11: 50,265,707 M547R possibly damaging Het
Mapk7 T C 11: 61,493,863 K6E possibly damaging Het
Mbd5 T A 2: 49,257,381 N534K possibly damaging Het
Mcat G A 15: 83,549,252 Q34* probably null Het
Mcu T A 10: 59,448,848 D180V probably damaging Het
Mettl21c G T 1: 44,009,791 P199T probably benign Het
Mndal A T 1: 173,872,875 S177T probably benign Het
Mpeg1 G T 19: 12,461,247 C23F probably benign Het
Mup15 T A 4: 61,438,234 Y98F probably benign Het
Myh8 T C 11: 67,289,812 S625P probably benign Het
Nipsnap2 T C 5: 129,753,218 probably benign Het
Nlrp4e T C 7: 23,320,372 S95P probably benign Het
Olfr1196 T C 2: 88,700,762 D189G probably damaging Het
Olfr378 T A 11: 73,425,827 D52V possibly damaging Het
Otop2 A G 11: 115,329,849 probably null Het
Pcnx4 G C 12: 72,574,400 G998A probably benign Het
Pnkd C A 1: 74,351,522 probably null Het
Ppp4r4 T A 12: 103,606,945 V701E probably benign Het
Ryr2 A G 13: 11,601,841 I3897T probably damaging Het
Scn1a T C 2: 66,332,287 E205G probably damaging Het
Serpinb5 A T 1: 106,876,052 Q156L probably benign Het
Setdb1 A T 3: 95,327,467 V975D probably benign Het
Shc1 A G 3: 89,428,445 *470W probably null Het
Sik3 T A 9: 46,202,022 V587E probably damaging Het
Sik3 C A 9: 46,221,089 H1276Q probably benign Het
Spata7 T C 12: 98,668,861 I384T probably damaging Het
Tanc2 T A 11: 105,922,137 V1469D probably benign Het
Tdrd5 A T 1: 156,255,802 N888K probably benign Het
Tex22 T C 12: 113,075,380 S34P probably benign Het
Tmed6 T C 8: 107,064,122 T98A probably benign Het
Trim66 G A 7: 109,484,619 P141L probably benign Het
Trpa1 T C 1: 14,885,812 I778V probably benign Het
Urb2 T A 8: 124,028,077 H174Q probably damaging Het
Usb1 T C 8: 95,338,697 V59A probably benign Het
Vmn1r11 T A 6: 57,137,409 N19K probably damaging Het
Vmn1r185 A T 7: 26,611,794 F95L probably benign Het
Vmn1r206 C T 13: 22,620,990 V16M probably benign Het
Vmn2r92 T C 17: 18,167,363 V210A probably benign Het
Wdr17 A T 8: 54,672,501 I448K possibly damaging Het
Zfp768 T A 7: 127,343,561 Q465L probably damaging Het
Zfp804b T A 5: 6,771,105 N617Y probably damaging Het
Other mutations in Sdk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Sdk2 APN 11 113854384 missense possibly damaging 0.86
IGL01063:Sdk2 APN 11 113830842 missense probably damaging 1.00
IGL01291:Sdk2 APN 11 113843080 missense probably benign
IGL01316:Sdk2 APN 11 113867965 missense probably benign 0.09
IGL01614:Sdk2 APN 11 113793858 missense probably damaging 1.00
IGL01998:Sdk2 APN 11 113838532 missense probably damaging 0.98
IGL02014:Sdk2 APN 11 113838494 missense probably damaging 1.00
IGL02095:Sdk2 APN 11 113834830 missense probably damaging 1.00
IGL02115:Sdk2 APN 11 113834813 splice site probably benign
IGL02543:Sdk2 APN 11 113868921 missense possibly damaging 0.90
IGL02976:Sdk2 APN 11 113851842 missense probably damaging 1.00
IGL03001:Sdk2 APN 11 113821626 missense probably benign 0.00
IGL03122:Sdk2 APN 11 113842068 missense probably damaging 1.00
IGL03183:Sdk2 APN 11 113850984 missense probably benign 0.19
IGL03222:Sdk2 APN 11 113838431 missense probably benign 0.01
IGL03310:Sdk2 APN 11 113793325 missense possibly damaging 0.77
ANU05:Sdk2 UTSW 11 113843080 missense probably benign
R0008:Sdk2 UTSW 11 113856755 missense probably damaging 1.00
R0008:Sdk2 UTSW 11 113856755 missense probably damaging 1.00
R0088:Sdk2 UTSW 11 113827086 missense possibly damaging 0.74
R0096:Sdk2 UTSW 11 113903144 splice site probably benign
R0386:Sdk2 UTSW 11 113893464 missense probably damaging 0.96
R0396:Sdk2 UTSW 11 113829967 missense probably benign 0.04
R0409:Sdk2 UTSW 11 113850891 splice site probably benign
R0416:Sdk2 UTSW 11 113803203 missense probably damaging 1.00
R0456:Sdk2 UTSW 11 113791466 missense possibly damaging 0.93
R0544:Sdk2 UTSW 11 113781010 missense probably damaging 1.00
R0691:Sdk2 UTSW 11 113794920 splice site probably null
R0711:Sdk2 UTSW 11 113903144 splice site probably benign
R0717:Sdk2 UTSW 11 113832326 missense probably damaging 1.00
R0780:Sdk2 UTSW 11 113893508 missense probably benign 0.07
R0831:Sdk2 UTSW 11 113832258 missense probably damaging 0.96
R0853:Sdk2 UTSW 11 113821415 missense probably benign 0.00
R0865:Sdk2 UTSW 11 113850922 missense probably benign 0.12
R0930:Sdk2 UTSW 11 113838445 missense probably benign 0.01
R0964:Sdk2 UTSW 11 113806417 splice site probably benign
R1051:Sdk2 UTSW 11 113838646 synonymous silent
R1052:Sdk2 UTSW 11 113838646 synonymous silent
R1054:Sdk2 UTSW 11 113838646 synonymous silent
R1055:Sdk2 UTSW 11 113838646 synonymous silent
R1077:Sdk2 UTSW 11 113838646 synonymous silent
R1079:Sdk2 UTSW 11 113838646 synonymous silent
R1115:Sdk2 UTSW 11 113838646 synonymous silent
R1186:Sdk2 UTSW 11 113838646 synonymous silent
R1187:Sdk2 UTSW 11 113838646 synonymous silent
R1337:Sdk2 UTSW 11 113832331 missense possibly damaging 0.79
R1430:Sdk2 UTSW 11 113838646 synonymous silent
R1433:Sdk2 UTSW 11 113795045 missense probably damaging 0.99
R1464:Sdk2 UTSW 11 113830080 missense possibly damaging 0.86
R1464:Sdk2 UTSW 11 113830080 missense possibly damaging 0.86
R1514:Sdk2 UTSW 11 113838646 synonymous silent
R1529:Sdk2 UTSW 11 113838646 synonymous silent
R1596:Sdk2 UTSW 11 113838609 splice site probably benign
R1680:Sdk2 UTSW 11 113791436 missense possibly damaging 0.47
R1680:Sdk2 UTSW 11 113838646 synonymous silent
R1770:Sdk2 UTSW 11 113793741 missense probably benign 0.05
R1858:Sdk2 UTSW 11 113838646 synonymous silent
R1866:Sdk2 UTSW 11 113838646 synonymous silent
R1874:Sdk2 UTSW 11 113834956 missense probably benign 0.00
R1899:Sdk2 UTSW 11 113838646 synonymous silent
R1905:Sdk2 UTSW 11 113838646 synonymous silent
R1907:Sdk2 UTSW 11 113838646 synonymous silent
R1913:Sdk2 UTSW 11 113856726 missense possibly damaging 0.77
R1964:Sdk2 UTSW 11 113781017 nonsense probably null
R2055:Sdk2 UTSW 11 113850954 missense probably damaging 1.00
R2059:Sdk2 UTSW 11 113854332 missense probably damaging 1.00
R2093:Sdk2 UTSW 11 113943122 missense probably damaging 1.00
R2256:Sdk2 UTSW 11 113830794 missense probably benign 0.44
R3720:Sdk2 UTSW 11 113800244 missense probably damaging 1.00
R3795:Sdk2 UTSW 11 113856696 nonsense probably null
R4037:Sdk2 UTSW 11 113795055 missense probably damaging 1.00
R4171:Sdk2 UTSW 11 113866989 splice site probably null
R4717:Sdk2 UTSW 11 113854369 missense probably damaging 0.96
R4758:Sdk2 UTSW 11 113827054 missense possibly damaging 0.87
R4857:Sdk2 UTSW 11 113821382 nonsense probably null
R4924:Sdk2 UTSW 11 113857758 missense probably damaging 1.00
R5015:Sdk2 UTSW 11 113793761 missense probably damaging 1.00
R5171:Sdk2 UTSW 11 113850982 missense probably benign 0.01
R5239:Sdk2 UTSW 11 113868033 missense probably damaging 1.00
R5243:Sdk2 UTSW 11 113825086 missense possibly damaging 0.76
R5279:Sdk2 UTSW 11 113867031 missense probably benign 0.31
R5535:Sdk2 UTSW 11 113943158 missense possibly damaging 0.80
R5634:Sdk2 UTSW 11 113851714 missense probably damaging 1.00
R5637:Sdk2 UTSW 11 113833179 missense probably damaging 1.00
R5726:Sdk2 UTSW 11 113851800 missense probably damaging 1.00
R5793:Sdk2 UTSW 11 113868952 missense possibly damaging 0.46
R5798:Sdk2 UTSW 11 113827116 missense probably damaging 1.00
R5834:Sdk2 UTSW 11 113854273 missense probably damaging 1.00
R5863:Sdk2 UTSW 11 113834984 missense probably damaging 0.98
R5869:Sdk2 UTSW 11 113851882 missense probably damaging 0.96
R5875:Sdk2 UTSW 11 113830059 missense probably benign 0.00
R5953:Sdk2 UTSW 11 113793744 missense probably damaging 1.00
R5991:Sdk2 UTSW 11 113943254 missense probably damaging 0.97
R6018:Sdk2 UTSW 11 113830063 missense probably benign 0.00
R6116:Sdk2 UTSW 11 113854364 missense probably damaging 0.99
R6328:Sdk2 UTSW 11 113793755 missense probably damaging 1.00
R6348:Sdk2 UTSW 11 113893508 missense probably benign 0.07
R6383:Sdk2 UTSW 11 113832265 missense probably damaging 1.00
R6824:Sdk2 UTSW 11 113867934 missense probably benign 0.43
R6835:Sdk2 UTSW 11 113830048 missense probably damaging 0.98
R6853:Sdk2 UTSW 11 113780929 missense probably damaging 0.99
R6912:Sdk2 UTSW 11 113903120 missense probably benign 0.03
R7000:Sdk2 UTSW 11 113803169 missense probably damaging 1.00
R7099:Sdk2 UTSW 11 113834905 missense probably damaging 0.98
R7102:Sdk2 UTSW 11 113842690 nonsense probably null
R7177:Sdk2 UTSW 11 113829969 missense possibly damaging 0.91
R7381:Sdk2 UTSW 11 113838489 missense probably damaging 0.98
R7504:Sdk2 UTSW 11 113867967 missense possibly damaging 0.50
R7552:Sdk2 UTSW 11 113873213 missense possibly damaging 0.63
V1662:Sdk2 UTSW 11 113834908 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAGAGACTCCATCTGGCCCCAGAC -3'
(R):5'- TCATGCCCTGTGAGAGACTGTATCATC -3'

Sequencing Primer
(F):5'- CCAGTCTAGCCAGAGTAGGG -3'
(R):5'- GGGGGCCTTTCTTTCTTCAT -3'
Posted On2014-04-13