Incidental Mutation 'R1498:Zfp292'
ID169017
Institutional Source Beutler Lab
Gene Symbol Zfp292
Ensembl Gene ENSMUSG00000039967
Gene Namezinc finger protein 292
SynonymsZn-16, 5730450D02Rik, Zfp15, Zn-15, Zfp-15, 9430062L07Rik, Krox-10
MMRRC Submission 039549-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.716) question?
Stock #R1498 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location34803113-34882960 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 34805397 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 2549 (A2549E)
Ref Sequence ENSEMBL: ENSMUSP00000095766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047950] [ENSMUST00000098163]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047950
AA Change: A2554E

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037233
Gene: ENSMUSG00000039967
AA Change: A2554E

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 101 120 N/A INTRINSIC
low complexity region 512 523 N/A INTRINSIC
ZnF_C2H2 540 561 5.12e1 SMART
ZnF_C2H2 567 589 4.72e-2 SMART
low complexity region 649 664 N/A INTRINSIC
ZnF_C2H2 681 705 3.52e-1 SMART
ZnF_C2H2 722 744 1.53e-1 SMART
ZnF_C2H2 750 774 1.62e0 SMART
ZnF_C2H2 779 803 1.08e1 SMART
ZnF_C2H2 807 831 1.95e-3 SMART
low complexity region 1062 1078 N/A INTRINSIC
ZnF_C2H2 1085 1110 7.67e-2 SMART
ZnF_C2H2 1361 1381 1.93e2 SMART
low complexity region 1606 1618 N/A INTRINSIC
ZnF_C2H2 1879 1904 4.4e-2 SMART
ZnF_C2H2 1924 1949 5.42e-2 SMART
low complexity region 2004 2014 N/A INTRINSIC
low complexity region 2024 2037 N/A INTRINSIC
coiled coil region 2050 2072 N/A INTRINSIC
ZnF_C2H2 2091 2116 4.45e0 SMART
low complexity region 2121 2143 N/A INTRINSIC
ZnF_C2H2 2149 2174 1.64e-1 SMART
ZnF_C2H2 2193 2218 3.24e0 SMART
ZnF_C2H2 2233 2258 1.18e-2 SMART
low complexity region 2301 2314 N/A INTRINSIC
ZnF_C2H2 2362 2386 2.86e-1 SMART
low complexity region 2589 2605 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098163
AA Change: A2549E

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095766
Gene: ENSMUSG00000039967
AA Change: A2549E

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 101 120 N/A INTRINSIC
low complexity region 507 518 N/A INTRINSIC
ZnF_C2H2 535 556 5.12e1 SMART
ZnF_C2H2 562 584 4.72e-2 SMART
low complexity region 644 659 N/A INTRINSIC
ZnF_C2H2 676 700 3.52e-1 SMART
ZnF_C2H2 717 739 1.53e-1 SMART
ZnF_C2H2 745 769 1.62e0 SMART
ZnF_C2H2 774 798 1.08e1 SMART
ZnF_C2H2 802 826 1.95e-3 SMART
low complexity region 1057 1073 N/A INTRINSIC
ZnF_C2H2 1080 1105 7.67e-2 SMART
ZnF_C2H2 1356 1376 1.93e2 SMART
low complexity region 1601 1613 N/A INTRINSIC
ZnF_C2H2 1874 1899 4.4e-2 SMART
ZnF_C2H2 1919 1944 5.42e-2 SMART
low complexity region 1999 2009 N/A INTRINSIC
low complexity region 2019 2032 N/A INTRINSIC
coiled coil region 2045 2067 N/A INTRINSIC
ZnF_C2H2 2086 2111 4.45e0 SMART
low complexity region 2116 2138 N/A INTRINSIC
ZnF_C2H2 2144 2169 1.64e-1 SMART
ZnF_C2H2 2188 2213 3.24e0 SMART
ZnF_C2H2 2228 2253 1.18e-2 SMART
low complexity region 2296 2309 N/A INTRINSIC
ZnF_C2H2 2357 2381 2.86e-1 SMART
low complexity region 2584 2600 N/A INTRINSIC
Meta Mutation Damage Score 0.1032 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 97% (83/86)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,931,371 H435R probably benign Het
Acly A G 11: 100,483,801 S799P probably benign Het
Acvr1b T C 15: 101,194,010 F57S probably benign Het
Adamts5 T A 16: 85,900,102 T56S possibly damaging Het
Adrb2 T C 18: 62,178,933 T274A probably damaging Het
Agr3 A T 12: 35,934,380 probably null Het
Ankrd6 A G 4: 32,810,289 M405T probably benign Het
Aqp5 T C 15: 99,593,247 I60T probably damaging Het
Arf5 G T 6: 28,426,154 R180L probably benign Het
Asap3 A G 4: 136,239,194 N528D probably benign Het
Atmin G A 8: 116,954,801 E180K probably benign Het
Bcl11a A T 11: 24,164,005 E449D probably damaging Het
Cep128 A T 12: 91,366,417 F25I probably benign Het
Cfp GCAC GC X: 20,929,666 probably null Het
Chpt1 T A 10: 88,477,104 Y282F possibly damaging Het
Cul7 A G 17: 46,655,710 D355G probably benign Het
Daxx T C 17: 33,912,253 Y385H probably damaging Het
Dnah2 A C 11: 69,520,667 probably null Het
Dscc1 CTGAATGAAT CTGAAT 15: 55,080,176 probably benign Het
Erc2 T A 14: 28,302,898 M578K probably benign Het
Evc T A 5: 37,323,700 H267L possibly damaging Het
Exosc10 A C 4: 148,581,786 Q837P possibly damaging Het
Fasn G A 11: 120,815,419 T1033I probably damaging Het
Fat1 C A 8: 45,025,484 Y2522* probably null Het
Fbxw8 G A 5: 118,065,785 probably benign Het
Fyn A G 10: 39,532,124 D321G possibly damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm156 A G 6: 129,771,740 S105P probably damaging Het
Grm6 G A 11: 50,857,256 V398M probably damaging Het
Gtpbp1 T A 15: 79,719,021 probably null Het
Hnf1a A G 5: 114,970,537 V103A probably damaging Het
Hsp90aa1 A T 12: 110,695,688 probably null Het
Iqgap2 C T 13: 95,646,805 V1288I probably benign Het
Irx5 A G 8: 92,359,886 D199G probably damaging Het
Krt9 G T 11: 100,188,369 C732* probably null Het
Lifr T C 15: 7,190,618 S910P probably damaging Het
Lrig1 G A 6: 94,627,987 A209V possibly damaging Het
Lrrk1 T A 7: 66,302,671 R506* probably null Het
Lyst T A 13: 13,650,375 I1525K possibly damaging Het
Mad2l1 C T 6: 66,539,842 Q173* probably null Het
Mcoln1 T A 8: 3,512,861 I524N probably damaging Het
Mmp3 A T 9: 7,446,967 D49V possibly damaging Het
Morc3 A T 16: 93,853,855 N321I probably damaging Het
Mrpl48 T C 7: 100,546,488 probably benign Het
Myo6 T A 9: 80,307,679 D1231E probably damaging Het
Nlrc4 A G 17: 74,446,413 I325T probably benign Het
Olfr1079 A G 2: 86,538,558 V117A probably benign Het
Olfr1314 A T 2: 112,092,593 M36K probably benign Het
Olfr348 A T 2: 36,787,346 I274F probably damaging Het
Olfr699 T C 7: 106,790,416 Y195C possibly damaging Het
Olfr894 C G 9: 38,219,380 P183A probably damaging Het
Parvg T A 15: 84,334,631 S230T possibly damaging Het
Pcca T C 14: 122,616,818 I118T probably damaging Het
Pde6a A G 18: 61,232,860 N219S possibly damaging Het
Phldb1 G T 9: 44,701,618 P935Q possibly damaging Het
Plppr5 T C 3: 117,662,612 S261P probably damaging Het
Ppl T C 16: 5,104,765 N260S probably benign Het
Ppp1r3e A T 14: 54,876,425 H263Q probably benign Het
Ppp3cb T C 14: 20,509,499 probably null Het
Ppt2 A T 17: 34,623,101 D185E probably benign Het
Prr27 A T 5: 87,850,741 probably benign Het
Ptcd3 A T 6: 71,893,495 V327E probably damaging Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Rtp1 A T 16: 23,431,220 M112L probably benign Het
Slc22a5 A T 11: 53,869,314 L392Q probably damaging Het
Slc6a7 A G 18: 60,996,692 I614T probably benign Het
Slu7 C A 11: 43,438,217 P89T possibly damaging Het
Smarcc2 T C 10: 128,482,192 V618A probably benign Het
Sorl1 C T 9: 42,041,073 R729Q probably damaging Het
Sptbn2 T C 19: 4,744,246 F1493L possibly damaging Het
Sulf1 C T 1: 12,848,350 T66I probably damaging Het
Tgtp2 A G 11: 49,059,338 Y136H probably damaging Het
Tmem117 T C 15: 94,638,361 F92S probably damaging Het
Tmprss9 T A 10: 80,895,100 V820E probably benign Het
Tpcn2 A G 7: 145,268,911 Y266H probably damaging Het
Trat1 A G 16: 48,734,941 S143P probably benign Het
Vmn1r49 T A 6: 90,072,316 R235W probably damaging Het
Vmn1r71 A T 7: 10,748,648 C38S probably benign Het
Vmn2r6 T A 3: 64,556,469 T315S probably damaging Het
Wdr36 A G 18: 32,852,968 D575G possibly damaging Het
Zfp354a A T 11: 51,070,246 H426L probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp648 T A 1: 154,205,373 I426N probably damaging Het
Zfp72 T C 13: 74,372,617 N114S probably benign Het
Other mutations in Zfp292
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Zfp292 APN 4 34808683 missense probably benign 0.15
IGL00502:Zfp292 APN 4 34809775 missense possibly damaging 0.63
IGL00539:Zfp292 APN 4 34808790 missense probably damaging 0.98
IGL00676:Zfp292 APN 4 34807827 missense probably damaging 0.99
IGL01068:Zfp292 APN 4 34806763 missense probably damaging 1.00
IGL01311:Zfp292 APN 4 34807961 missense probably benign 0.01
IGL01639:Zfp292 APN 4 34809048 missense probably benign 0.04
IGL01688:Zfp292 APN 4 34807855 missense possibly damaging 0.93
IGL02345:Zfp292 APN 4 34809244 missense possibly damaging 0.94
IGL02444:Zfp292 APN 4 34808810 missense possibly damaging 0.87
IGL02548:Zfp292 APN 4 34805416 missense probably damaging 1.00
IGL02551:Zfp292 APN 4 34806462 missense possibly damaging 0.93
IGL02702:Zfp292 APN 4 34809415 missense probably benign 0.14
IGL02715:Zfp292 APN 4 34819542 missense probably damaging 1.00
IGL03273:Zfp292 APN 4 34806163 missense probably benign 0.00
F5770:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
PIT4362001:Zfp292 UTSW 4 34807524 missense probably benign 0.00
R0153:Zfp292 UTSW 4 34811185 missense probably benign 0.26
R0184:Zfp292 UTSW 4 34819563 missense probably damaging 1.00
R0295:Zfp292 UTSW 4 34806281 missense probably damaging 1.00
R0367:Zfp292 UTSW 4 34808227 missense probably benign 0.25
R0433:Zfp292 UTSW 4 34839959 missense probably damaging 0.99
R0481:Zfp292 UTSW 4 34810059 missense probably benign 0.28
R0555:Zfp292 UTSW 4 34807194 missense probably damaging 1.00
R0597:Zfp292 UTSW 4 34807399 missense probably benign 0.02
R0748:Zfp292 UTSW 4 34816424 splice site probably benign
R0782:Zfp292 UTSW 4 34839382 missense possibly damaging 0.94
R0834:Zfp292 UTSW 4 34809114 missense probably benign 0.00
R0879:Zfp292 UTSW 4 34811218 missense probably benign 0.00
R1083:Zfp292 UTSW 4 34807569 missense probably damaging 0.98
R1343:Zfp292 UTSW 4 34805238 missense probably damaging 0.98
R1714:Zfp292 UTSW 4 34808935 missense probably damaging 1.00
R1724:Zfp292 UTSW 4 34811237 missense probably damaging 1.00
R1755:Zfp292 UTSW 4 34811043 missense probably benign 0.02
R1837:Zfp292 UTSW 4 34810264 missense probably damaging 0.98
R1914:Zfp292 UTSW 4 34805100 missense possibly damaging 0.92
R1915:Zfp292 UTSW 4 34805100 missense possibly damaging 0.92
R1936:Zfp292 UTSW 4 34807452 missense probably benign 0.22
R2107:Zfp292 UTSW 4 34808593 missense possibly damaging 0.86
R2108:Zfp292 UTSW 4 34808593 missense possibly damaging 0.86
R2136:Zfp292 UTSW 4 34810266 missense probably benign 0.13
R2182:Zfp292 UTSW 4 34807417 missense probably damaging 1.00
R2186:Zfp292 UTSW 4 34807962 missense probably benign 0.07
R2306:Zfp292 UTSW 4 34809468 missense probably damaging 0.96
R2350:Zfp292 UTSW 4 34811281 missense probably damaging 1.00
R2382:Zfp292 UTSW 4 34806426 missense possibly damaging 0.91
R2872:Zfp292 UTSW 4 34808595 missense probably damaging 1.00
R2872:Zfp292 UTSW 4 34808595 missense probably damaging 1.00
R3018:Zfp292 UTSW 4 34808814 missense probably damaging 0.99
R3812:Zfp292 UTSW 4 34810326 missense probably damaging 0.98
R4006:Zfp292 UTSW 4 34807744 missense probably benign 0.00
R4006:Zfp292 UTSW 4 34809611 missense possibly damaging 0.62
R4060:Zfp292 UTSW 4 34810863 missense probably damaging 1.00
R4062:Zfp292 UTSW 4 34810863 missense probably damaging 1.00
R4063:Zfp292 UTSW 4 34810863 missense probably damaging 1.00
R4064:Zfp292 UTSW 4 34810863 missense probably damaging 1.00
R4207:Zfp292 UTSW 4 34806079 missense probably benign 0.04
R4641:Zfp292 UTSW 4 34807828 missense probably damaging 0.99
R4684:Zfp292 UTSW 4 34807078 missense probably benign 0.00
R4718:Zfp292 UTSW 4 34819521 missense possibly damaging 0.92
R4865:Zfp292 UTSW 4 34819563 missense probably damaging 1.00
R4870:Zfp292 UTSW 4 34808917 missense probably damaging 1.00
R5097:Zfp292 UTSW 4 34839878 missense possibly damaging 0.89
R5233:Zfp292 UTSW 4 34809755 missense probably damaging 1.00
R5246:Zfp292 UTSW 4 34805842 missense possibly damaging 0.76
R5369:Zfp292 UTSW 4 34807491 missense possibly damaging 0.89
R5527:Zfp292 UTSW 4 34806261 missense probably damaging 1.00
R5621:Zfp292 UTSW 4 34811703 missense probably damaging 0.98
R5770:Zfp292 UTSW 4 34806747 missense probably damaging 1.00
R5900:Zfp292 UTSW 4 34805125 missense probably damaging 1.00
R5905:Zfp292 UTSW 4 34819549 missense probably damaging 1.00
R5994:Zfp292 UTSW 4 34805464 missense possibly damaging 0.87
R6028:Zfp292 UTSW 4 34819549 missense probably damaging 1.00
R6056:Zfp292 UTSW 4 34809784 missense probably damaging 1.00
R6093:Zfp292 UTSW 4 34811902 missense probably damaging 1.00
R6126:Zfp292 UTSW 4 34808497 missense probably benign 0.13
R6209:Zfp292 UTSW 4 34809442 missense probably benign 0.14
R6275:Zfp292 UTSW 4 34808883 missense possibly damaging 0.93
R6523:Zfp292 UTSW 4 34816301 missense probably benign 0.21
R6747:Zfp292 UTSW 4 34806894 missense probably damaging 0.97
R6752:Zfp292 UTSW 4 34808593 missense possibly damaging 0.86
R6967:Zfp292 UTSW 4 34807812 missense probably damaging 1.00
R7038:Zfp292 UTSW 4 34816357 missense probably damaging 1.00
R7056:Zfp292 UTSW 4 34809784 missense probably damaging 1.00
R7088:Zfp292 UTSW 4 34806796 missense probably damaging 1.00
R7158:Zfp292 UTSW 4 34808679 missense probably benign
R7254:Zfp292 UTSW 4 34819476 missense probably damaging 0.98
R7350:Zfp292 UTSW 4 34806839 missense probably benign
R7378:Zfp292 UTSW 4 34808384 missense probably benign 0.26
R7535:Zfp292 UTSW 4 34811487 missense probably benign 0.28
R7589:Zfp292 UTSW 4 34806777 missense probably damaging 1.00
R7816:Zfp292 UTSW 4 34809865 missense probably benign 0.02
V7580:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
V7581:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
V7582:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
V7583:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AACATGTCTTCTGGAGCTGGAATGG -3'
(R):5'- AGCGATATGGCAACCCACAAGG -3'

Sequencing Primer
(F):5'- TCTGCTTCACTGCAGACTCT -3'
(R):5'- TCAGGAGCATGATTCCTGCAC -3'
Posted On2014-04-13