Incidental Mutation 'R1498:Olfr699'
ID169038
Institutional Source Beutler Lab
Gene Symbol Olfr699
Ensembl Gene ENSMUSG00000096714
Gene Nameolfactory receptor 699
SynonymsMOR283-10P, GA_x6K02T2PBJ9-9168355-9167405
MMRRC Submission 039549-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R1498 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location106787963-106793198 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106790416 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 195 (Y195C)
Ref Sequence ENSEMBL: ENSMUSP00000149112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065024] [ENSMUST00000215952] [ENSMUST00000216307]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065024
AA Change: Y195C

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068023
Gene: ENSMUSG00000096714
AA Change: Y195C

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.3e-46 PFAM
Pfam:7TM_GPCR_Srsx 35 303 2.1e-5 PFAM
Pfam:7tm_1 41 290 1.1e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215952
AA Change: Y195C

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216307
AA Change: Y195C

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
Meta Mutation Damage Score 0.2903 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 97% (83/86)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,931,371 H435R probably benign Het
Acly A G 11: 100,483,801 S799P probably benign Het
Acvr1b T C 15: 101,194,010 F57S probably benign Het
Adamts5 T A 16: 85,900,102 T56S possibly damaging Het
Adrb2 T C 18: 62,178,933 T274A probably damaging Het
Agr3 A T 12: 35,934,380 probably null Het
Ankrd6 A G 4: 32,810,289 M405T probably benign Het
Aqp5 T C 15: 99,593,247 I60T probably damaging Het
Arf5 G T 6: 28,426,154 R180L probably benign Het
Asap3 A G 4: 136,239,194 N528D probably benign Het
Atmin G A 8: 116,954,801 E180K probably benign Het
Bcl11a A T 11: 24,164,005 E449D probably damaging Het
Cep128 A T 12: 91,366,417 F25I probably benign Het
Cfp GCAC GC X: 20,929,666 probably null Het
Chpt1 T A 10: 88,477,104 Y282F possibly damaging Het
Cul7 A G 17: 46,655,710 D355G probably benign Het
Daxx T C 17: 33,912,253 Y385H probably damaging Het
Dnah2 A C 11: 69,520,667 probably null Het
Dscc1 CTGAATGAAT CTGAAT 15: 55,080,176 probably benign Het
Erc2 T A 14: 28,302,898 M578K probably benign Het
Evc T A 5: 37,323,700 H267L possibly damaging Het
Exosc10 A C 4: 148,581,786 Q837P possibly damaging Het
Fasn G A 11: 120,815,419 T1033I probably damaging Het
Fat1 C A 8: 45,025,484 Y2522* probably null Het
Fbxw8 G A 5: 118,065,785 probably benign Het
Fyn A G 10: 39,532,124 D321G possibly damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm156 A G 6: 129,771,740 S105P probably damaging Het
Grm6 G A 11: 50,857,256 V398M probably damaging Het
Gtpbp1 T A 15: 79,719,021 probably null Het
Hnf1a A G 5: 114,970,537 V103A probably damaging Het
Hsp90aa1 A T 12: 110,695,688 probably null Het
Iqgap2 C T 13: 95,646,805 V1288I probably benign Het
Irx5 A G 8: 92,359,886 D199G probably damaging Het
Krt9 G T 11: 100,188,369 C732* probably null Het
Lifr T C 15: 7,190,618 S910P probably damaging Het
Lrig1 G A 6: 94,627,987 A209V possibly damaging Het
Lrrk1 T A 7: 66,302,671 R506* probably null Het
Lyst T A 13: 13,650,375 I1525K possibly damaging Het
Mad2l1 C T 6: 66,539,842 Q173* probably null Het
Mcoln1 T A 8: 3,512,861 I524N probably damaging Het
Mmp3 A T 9: 7,446,967 D49V possibly damaging Het
Morc3 A T 16: 93,853,855 N321I probably damaging Het
Mrpl48 T C 7: 100,546,488 probably benign Het
Myo6 T A 9: 80,307,679 D1231E probably damaging Het
Nlrc4 A G 17: 74,446,413 I325T probably benign Het
Olfr1079 A G 2: 86,538,558 V117A probably benign Het
Olfr1314 A T 2: 112,092,593 M36K probably benign Het
Olfr348 A T 2: 36,787,346 I274F probably damaging Het
Olfr894 C G 9: 38,219,380 P183A probably damaging Het
Parvg T A 15: 84,334,631 S230T possibly damaging Het
Pcca T C 14: 122,616,818 I118T probably damaging Het
Pde6a A G 18: 61,232,860 N219S possibly damaging Het
Phldb1 G T 9: 44,701,618 P935Q possibly damaging Het
Plppr5 T C 3: 117,662,612 S261P probably damaging Het
Ppl T C 16: 5,104,765 N260S probably benign Het
Ppp1r3e A T 14: 54,876,425 H263Q probably benign Het
Ppp3cb T C 14: 20,509,499 probably null Het
Ppt2 A T 17: 34,623,101 D185E probably benign Het
Prr27 A T 5: 87,850,741 probably benign Het
Ptcd3 A T 6: 71,893,495 V327E probably damaging Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Rtp1 A T 16: 23,431,220 M112L probably benign Het
Slc22a5 A T 11: 53,869,314 L392Q probably damaging Het
Slc6a7 A G 18: 60,996,692 I614T probably benign Het
Slu7 C A 11: 43,438,217 P89T possibly damaging Het
Smarcc2 T C 10: 128,482,192 V618A probably benign Het
Sorl1 C T 9: 42,041,073 R729Q probably damaging Het
Sptbn2 T C 19: 4,744,246 F1493L possibly damaging Het
Sulf1 C T 1: 12,848,350 T66I probably damaging Het
Tgtp2 A G 11: 49,059,338 Y136H probably damaging Het
Tmem117 T C 15: 94,638,361 F92S probably damaging Het
Tmprss9 T A 10: 80,895,100 V820E probably benign Het
Tpcn2 A G 7: 145,268,911 Y266H probably damaging Het
Trat1 A G 16: 48,734,941 S143P probably benign Het
Vmn1r49 T A 6: 90,072,316 R235W probably damaging Het
Vmn1r71 A T 7: 10,748,648 C38S probably benign Het
Vmn2r6 T A 3: 64,556,469 T315S probably damaging Het
Wdr36 A G 18: 32,852,968 D575G possibly damaging Het
Zfp292 G T 4: 34,805,397 A2549E possibly damaging Het
Zfp354a A T 11: 51,070,246 H426L probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp648 T A 1: 154,205,373 I426N probably damaging Het
Zfp72 T C 13: 74,372,617 N114S probably benign Het
Other mutations in Olfr699
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Olfr699 APN 7 106790589 missense probably benign 0.12
IGL02093:Olfr699 APN 7 106790823 missense probably benign 0.12
IGL02404:Olfr699 APN 7 106790359 missense probably damaging 1.00
IGL03214:Olfr699 APN 7 106790345 missense probably benign
IGL03230:Olfr699 APN 7 106790704 missense probably damaging 1.00
R0194:Olfr699 UTSW 7 106790823 missense probably benign 0.12
R0523:Olfr699 UTSW 7 106790326 missense probably damaging 1.00
R1132:Olfr699 UTSW 7 106790551 missense possibly damaging 0.94
R1373:Olfr699 UTSW 7 106790756 missense probably benign 0.01
R1482:Olfr699 UTSW 7 106790333 missense probably benign 0.00
R1500:Olfr699 UTSW 7 106790821 missense probably damaging 1.00
R2656:Olfr699 UTSW 7 106790513 missense probably damaging 0.98
R4163:Olfr699 UTSW 7 106790279 missense probably damaging 1.00
R4638:Olfr699 UTSW 7 106790998 start codon destroyed probably null 1.00
R5104:Olfr699 UTSW 7 106790332 missense possibly damaging 0.81
R6216:Olfr699 UTSW 7 106790458 missense probably benign 0.23
R6976:Olfr699 UTSW 7 106790227 missense probably damaging 0.99
R7129:Olfr699 UTSW 7 106790483 missense probably benign 0.00
R7130:Olfr699 UTSW 7 106790182 missense probably benign 0.35
R8104:Olfr699 UTSW 7 106791130 start gained probably benign
R8104:Olfr699 UTSW 7 106791131 start gained probably benign
Z1177:Olfr699 UTSW 7 106790270 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGAGAGCCCCATAGTACAGACC -3'
(R):5'- ACACTTGGTGGTGCAGAAGACCTC -3'

Sequencing Primer
(F):5'- TAGTACAGACCAACTACTGTCAAGTG -3'
(R):5'- CCTTCATGGCCTATGACAGGTATG -3'
Posted On2014-04-13