Incidental Mutation 'R1498:Sorl1'
ID169046
Institutional Source Beutler Lab
Gene Symbol Sorl1
Ensembl Gene ENSMUSG00000049313
Gene Namesortilin-related receptor, LDLR class A repeats-containing
Synonyms2900010L19Rik, mSorLA, Sorla, LR11
MMRRC Submission 039549-MU
Accession Numbers

Genbank: NM_011436; MGI: 1202296

Is this an essential gene? Possibly non essential (E-score: 0.499) question?
Stock #R1498 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location41964720-42124297 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 42041073 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 729 (R729Q)
Ref Sequence ENSEMBL: ENSMUSP00000058613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060989]
Predicted Effect probably damaging
Transcript: ENSMUST00000060989
AA Change: R729Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: R729Q

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VPS10 124 757 N/A SMART
LY 780 822 9.33e-6 SMART
LY 824 866 2.38e-12 SMART
LY 867 912 1.87e-5 SMART
LY 913 953 1.08e-10 SMART
LY 954 993 5.43e0 SMART
EGF_like 1020 1072 2.8e1 SMART
LDLa 1077 1114 1.76e-14 SMART
LDLa 1116 1155 5.34e-14 SMART
LDLa 1157 1194 1.67e-15 SMART
EGF_like 1198 1236 4.93e1 SMART
LDLa 1198 1237 3.83e-15 SMART
LDLa 1238 1273 1.99e-13 SMART
LDLa 1274 1317 2.53e-6 SMART
LDLa 1324 1361 4.34e-14 SMART
LDLa 1367 1405 1.14e-13 SMART
LDLa 1418 1455 3.34e-15 SMART
LDLa 1470 1508 1.09e-10 SMART
LDLa 1513 1551 1.09e-10 SMART
FN3 1555 1638 4.19e-4 SMART
FN3 1651 1732 7.23e-8 SMART
FN3 1747 1830 4.8e0 SMART
FN3 1842 1920 3e1 SMART
FN3 1933 2016 6.01e-5 SMART
FN3 2025 2107 2.03e-2 SMART
transmembrane domain 2137 2159 N/A INTRINSIC
low complexity region 2188 2199 N/A INTRINSIC
Meta Mutation Damage Score 0.2843 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 97% (83/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,931,371 H435R probably benign Het
Acly A G 11: 100,483,801 S799P probably benign Het
Acvr1b T C 15: 101,194,010 F57S probably benign Het
Adamts5 T A 16: 85,900,102 T56S possibly damaging Het
Adrb2 T C 18: 62,178,933 T274A probably damaging Het
Agr3 A T 12: 35,934,380 probably null Het
Ankrd6 A G 4: 32,810,289 M405T probably benign Het
Aqp5 T C 15: 99,593,247 I60T probably damaging Het
Arf5 G T 6: 28,426,154 R180L probably benign Het
Asap3 A G 4: 136,239,194 N528D probably benign Het
Atmin G A 8: 116,954,801 E180K probably benign Het
Bcl11a A T 11: 24,164,005 E449D probably damaging Het
Cep128 A T 12: 91,366,417 F25I probably benign Het
Cfp GCAC GC X: 20,929,666 probably null Het
Chpt1 T A 10: 88,477,104 Y282F possibly damaging Het
Cul7 A G 17: 46,655,710 D355G probably benign Het
Daxx T C 17: 33,912,253 Y385H probably damaging Het
Dnah2 A C 11: 69,520,667 probably null Het
Dscc1 CTGAATGAAT CTGAAT 15: 55,080,176 probably benign Het
Erc2 T A 14: 28,302,898 M578K probably benign Het
Evc T A 5: 37,323,700 H267L possibly damaging Het
Exosc10 A C 4: 148,581,786 Q837P possibly damaging Het
Fasn G A 11: 120,815,419 T1033I probably damaging Het
Fat1 C A 8: 45,025,484 Y2522* probably null Het
Fbxw8 G A 5: 118,065,785 probably benign Het
Fyn A G 10: 39,532,124 D321G possibly damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm156 A G 6: 129,771,740 S105P probably damaging Het
Grm6 G A 11: 50,857,256 V398M probably damaging Het
Gtpbp1 T A 15: 79,719,021 probably null Het
Hnf1a A G 5: 114,970,537 V103A probably damaging Het
Hsp90aa1 A T 12: 110,695,688 probably null Het
Iqgap2 C T 13: 95,646,805 V1288I probably benign Het
Irx5 A G 8: 92,359,886 D199G probably damaging Het
Krt9 G T 11: 100,188,369 C732* probably null Het
Lifr T C 15: 7,190,618 S910P probably damaging Het
Lrig1 G A 6: 94,627,987 A209V possibly damaging Het
Lrrk1 T A 7: 66,302,671 R506* probably null Het
Lyst T A 13: 13,650,375 I1525K possibly damaging Het
Mad2l1 C T 6: 66,539,842 Q173* probably null Het
Mcoln1 T A 8: 3,512,861 I524N probably damaging Het
Mmp3 A T 9: 7,446,967 D49V possibly damaging Het
Morc3 A T 16: 93,853,855 N321I probably damaging Het
Mrpl48 T C 7: 100,546,488 probably benign Het
Myo6 T A 9: 80,307,679 D1231E probably damaging Het
Nlrc4 A G 17: 74,446,413 I325T probably benign Het
Olfr1079 A G 2: 86,538,558 V117A probably benign Het
Olfr1314 A T 2: 112,092,593 M36K probably benign Het
Olfr348 A T 2: 36,787,346 I274F probably damaging Het
Olfr699 T C 7: 106,790,416 Y195C possibly damaging Het
Olfr894 C G 9: 38,219,380 P183A probably damaging Het
Parvg T A 15: 84,334,631 S230T possibly damaging Het
Pcca T C 14: 122,616,818 I118T probably damaging Het
Pde6a A G 18: 61,232,860 N219S possibly damaging Het
Phldb1 G T 9: 44,701,618 P935Q possibly damaging Het
Plppr5 T C 3: 117,662,612 S261P probably damaging Het
Ppl T C 16: 5,104,765 N260S probably benign Het
Ppp1r3e A T 14: 54,876,425 H263Q probably benign Het
Ppp3cb T C 14: 20,509,499 probably null Het
Ppt2 A T 17: 34,623,101 D185E probably benign Het
Prr27 A T 5: 87,850,741 probably benign Het
Ptcd3 A T 6: 71,893,495 V327E probably damaging Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Rtp1 A T 16: 23,431,220 M112L probably benign Het
Slc22a5 A T 11: 53,869,314 L392Q probably damaging Het
Slc6a7 A G 18: 60,996,692 I614T probably benign Het
Slu7 C A 11: 43,438,217 P89T possibly damaging Het
Smarcc2 T C 10: 128,482,192 V618A probably benign Het
Sptbn2 T C 19: 4,744,246 F1493L possibly damaging Het
Sulf1 C T 1: 12,848,350 T66I probably damaging Het
Tgtp2 A G 11: 49,059,338 Y136H probably damaging Het
Tmem117 T C 15: 94,638,361 F92S probably damaging Het
Tmprss9 T A 10: 80,895,100 V820E probably benign Het
Tpcn2 A G 7: 145,268,911 Y266H probably damaging Het
Trat1 A G 16: 48,734,941 S143P probably benign Het
Vmn1r49 T A 6: 90,072,316 R235W probably damaging Het
Vmn1r71 A T 7: 10,748,648 C38S probably benign Het
Vmn2r6 T A 3: 64,556,469 T315S probably damaging Het
Wdr36 A G 18: 32,852,968 D575G possibly damaging Het
Zfp292 G T 4: 34,805,397 A2549E possibly damaging Het
Zfp354a A T 11: 51,070,246 H426L probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp648 T A 1: 154,205,373 I426N probably damaging Het
Zfp72 T C 13: 74,372,617 N114S probably benign Het
Other mutations in Sorl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Sorl1 APN 9 41974094 missense probably damaging 1.00
IGL01303:Sorl1 APN 9 42024478 splice site probably benign
IGL01545:Sorl1 APN 9 42043956 missense probably damaging 1.00
IGL01629:Sorl1 APN 9 42057269 critical splice donor site probably null
IGL01670:Sorl1 APN 9 42001492 missense possibly damaging 0.81
IGL01684:Sorl1 APN 9 41980711 missense probably damaging 0.96
IGL02154:Sorl1 APN 9 42004034 missense probably benign
IGL02215:Sorl1 APN 9 42018182 missense probably damaging 0.97
IGL02427:Sorl1 APN 9 42041690 missense probably damaging 1.00
IGL02590:Sorl1 APN 9 42046561 missense probably benign 0.01
IGL02794:Sorl1 APN 9 42063774 missense probably damaging 0.98
IGL02797:Sorl1 APN 9 42037059 missense probably damaging 0.99
IGL02987:Sorl1 APN 9 42041053 missense probably damaging 1.00
IGL03005:Sorl1 APN 9 42057325 missense probably damaging 1.00
IGL03069:Sorl1 APN 9 41991426 missense probably benign
IGL03288:Sorl1 APN 9 42033562 splice site probably benign
N/A - 287:Sorl1 UTSW 9 42041596 nonsense probably null
PIT4151001:Sorl1 UTSW 9 41968622 missense probably damaging 1.00
R0117:Sorl1 UTSW 9 42033577 missense probably benign 0.10
R0173:Sorl1 UTSW 9 42067933 missense probably damaging 0.99
R0318:Sorl1 UTSW 9 42081954 missense probably damaging 1.00
R0385:Sorl1 UTSW 9 42031909 missense probably damaging 0.99
R0448:Sorl1 UTSW 9 42004088 missense probably damaging 1.00
R0492:Sorl1 UTSW 9 41991371 missense probably null 0.00
R0512:Sorl1 UTSW 9 42067832 missense probably benign 0.01
R0587:Sorl1 UTSW 9 41984506 missense probably damaging 1.00
R0600:Sorl1 UTSW 9 42043900 splice site probably benign
R0831:Sorl1 UTSW 9 42071069 splice site probably benign
R0924:Sorl1 UTSW 9 42008174 splice site probably benign
R1013:Sorl1 UTSW 9 42002559 missense probably benign 0.00
R1053:Sorl1 UTSW 9 41991456 missense probably benign
R1077:Sorl1 UTSW 9 42014490 missense probably damaging 1.00
R1326:Sorl1 UTSW 9 42031796 missense probably benign 0.14
R1348:Sorl1 UTSW 9 42000412 splice site probably null
R1671:Sorl1 UTSW 9 41974000 missense probably damaging 1.00
R1713:Sorl1 UTSW 9 41996242 missense probably benign 0.06
R1738:Sorl1 UTSW 9 42089965 missense probably benign 0.33
R1779:Sorl1 UTSW 9 41991482 critical splice acceptor site probably null
R1871:Sorl1 UTSW 9 41969725 nonsense probably null
R1912:Sorl1 UTSW 9 42081950 missense probably damaging 1.00
R1952:Sorl1 UTSW 9 42046624 missense probably benign
R2071:Sorl1 UTSW 9 41979457 missense possibly damaging 0.71
R2153:Sorl1 UTSW 9 41984492 missense probably benign 0.01
R2417:Sorl1 UTSW 9 41980711 missense probably damaging 0.96
R2429:Sorl1 UTSW 9 42037070 missense probably damaging 1.00
R2866:Sorl1 UTSW 9 41969781 missense probably benign
R3815:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3816:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3817:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3819:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3890:Sorl1 UTSW 9 42004105 missense probably damaging 1.00
R3941:Sorl1 UTSW 9 41989468 critical splice acceptor site probably null
R4409:Sorl1 UTSW 9 42035448 missense probably damaging 0.99
R4410:Sorl1 UTSW 9 42003992 nonsense probably null
R4610:Sorl1 UTSW 9 42031914 missense possibly damaging 0.65
R4664:Sorl1 UTSW 9 42004051 missense probably damaging 0.97
R4666:Sorl1 UTSW 9 42004051 missense probably damaging 0.97
R4668:Sorl1 UTSW 9 41984508 missense probably damaging 1.00
R4823:Sorl1 UTSW 9 41992321 missense probably damaging 1.00
R4874:Sorl1 UTSW 9 42063752 missense probably damaging 0.99
R4898:Sorl1 UTSW 9 42041639 missense probably damaging 1.00
R4922:Sorl1 UTSW 9 42014450 splice site probably null
R4976:Sorl1 UTSW 9 41983003 missense probably benign 0.00
R4984:Sorl1 UTSW 9 41991342 missense probably damaging 1.00
R5046:Sorl1 UTSW 9 41996294 missense probably benign
R5070:Sorl1 UTSW 9 42031818 missense possibly damaging 0.82
R5084:Sorl1 UTSW 9 41976377 missense probably benign 0.01
R5202:Sorl1 UTSW 9 42033583 missense probably benign 0.00
R5265:Sorl1 UTSW 9 42106516 missense possibly damaging 0.80
R5275:Sorl1 UTSW 9 42030902 missense probably benign 0.33
R5368:Sorl1 UTSW 9 41979390 missense probably benign 0.00
R5385:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5386:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5416:Sorl1 UTSW 9 42002636 nonsense probably null
R5518:Sorl1 UTSW 9 42037212 missense possibly damaging 0.92
R5545:Sorl1 UTSW 9 41991625 missense probably benign 0.08
R5864:Sorl1 UTSW 9 42092373 missense probably damaging 1.00
R5865:Sorl1 UTSW 9 41983034 missense possibly damaging 0.94
R6339:Sorl1 UTSW 9 41969742 missense probably benign 0.10
R6484:Sorl1 UTSW 9 41976407 missense probably damaging 1.00
R6505:Sorl1 UTSW 9 42071234 missense probably damaging 1.00
R6591:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6596:Sorl1 UTSW 9 42001603 missense possibly damaging 0.81
R6654:Sorl1 UTSW 9 41980645 missense possibly damaging 0.47
R6691:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6702:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6703:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6775:Sorl1 UTSW 9 42092452 missense possibly damaging 0.93
R6792:Sorl1 UTSW 9 42099263 missense probably damaging 1.00
R6852:Sorl1 UTSW 9 42024398 missense possibly damaging 0.90
R6860:Sorl1 UTSW 9 42022392 missense probably benign 0.01
R6925:Sorl1 UTSW 9 42033626 missense probably damaging 1.00
R7022:Sorl1 UTSW 9 41969751 missense probably benign 0.11
R7033:Sorl1 UTSW 9 42030983 missense possibly damaging 0.93
R7091:Sorl1 UTSW 9 42002634 missense probably benign 0.00
R7267:Sorl1 UTSW 9 42124079 missense possibly damaging 0.63
R7269:Sorl1 UTSW 9 42037203 missense probably damaging 0.99
R7272:Sorl1 UTSW 9 42063710 splice site probably null
R7537:Sorl1 UTSW 9 41980688 missense probably benign 0.01
R7615:Sorl1 UTSW 9 41977582 missense possibly damaging 0.91
R7636:Sorl1 UTSW 9 42092334 missense possibly damaging 0.90
R7727:Sorl1 UTSW 9 41984526 missense probably damaging 1.00
Z31818:Sorl1 UTSW 9 42041596 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGGATGAGACCAGAATGACCCAAC -3'
(R):5'- AGCTTTTCTGCAAGGCTGAGGAC -3'

Sequencing Primer
(F):5'- TGACCCAACCAGGTTTCAAG -3'
(R):5'- AGTGCTTCCCTGAGCAGTG -3'
Posted On2014-04-13