Mutagenetix > Incidental Mutation

Incidental Mutation 'R1498:Hsp90aa1'

169064

Institutional Source

Beutler Lab

Gene Symbol

Hsp90aa1

Ensembl Gene

ENSMUSG00000021270

Gene Name

heat shock protein 90, alpha (cytosolic), class A member 1

Synonyms

hsp4, Hspca, Hsp90, Hsp86-1, Hsp89

MMRRC Submission

039549-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1498 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

110690605-110702728 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 110695688 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000118189 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021698] [ENSMUST00000094361] [ENSMUST00000124156] [ENSMUST00000149189] [ENSMUST00000155242]

AlphaFold

P07901

Predicted Effect

probably benign
Transcript: ENSMUST00000021698

SMART Domains

Protein: ENSMUSP00000021698
Gene: ENSMUSG00000021270

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART
Pfam:HSP90	196	733	6.7e-272	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000094361

SMART Domains

Protein: ENSMUSP00000091921
Gene: ENSMUSG00000021270

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART
Pfam:HSP90	196	728	2e-245	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000124156

SMART Domains

Protein: ENSMUSP00000121138
Gene: ENSMUSG00000021270

Domain	Start	End	E-Value	Type
PDB:3HHU\|B	1	103	1e-69	PDB
SCOP:d1byqa_	11	103	5e-48	SMART
Blast:HATPase_c	40	103	7e-39	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129005

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134967

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145255

Predicted Effect

probably null
Transcript: ENSMUST00000149189

SMART Domains

Protein: ENSMUSP00000114201
Gene: ENSMUSG00000021270

Domain	Start	End	E-Value	Type
PDB:3HHU\|B	1	98	6e-66	PDB
SCOP:d1byqa_	11	98	2e-45	SMART
Blast:HATPase_c	40	98	2e-35	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000155242

SMART Domains

Protein: ENSMUSP00000118189
Gene: ENSMUSG00000021270

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.6%

Validation Efficiency

97% (83/86)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inducible molecular chaperone that functions as a homodimer. The encoded protein aids in the proper folding of specific target proteins by use of an ATPase activity that is modulated by co-chaperones. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male sterility associated with arrested male meiosis and male germ cell apoptosis. Mice homozygous for a transgenic gene disruption exhibit male sterility and small testis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	A	G	6: 48,931,371	H435R	probably benign	Het
Acly	A	G	11: 100,483,801	S799P	probably benign	Het
Acvr1b	T	C	15: 101,194,010	F57S	probably benign	Het
Adamts5	T	A	16: 85,900,102	T56S	possibly damaging	Het
Adrb2	T	C	18: 62,178,933	T274A	probably damaging	Het
Agr3	A	T	12: 35,934,380		probably null	Het
Ankrd6	A	G	4: 32,810,289	M405T	probably benign	Het
Aqp5	T	C	15: 99,593,247	I60T	probably damaging	Het
Arf5	G	T	6: 28,426,154	R180L	probably benign	Het
Asap3	A	G	4: 136,239,194	N528D	probably benign	Het
Atmin	G	A	8: 116,954,801	E180K	probably benign	Het
Bcl11a	A	T	11: 24,164,005	E449D	probably damaging	Het
Cep128	A	T	12: 91,366,417	F25I	probably benign	Het
Cfp	GCAC	GC	X: 20,929,666		probably null	Het
Chpt1	T	A	10: 88,477,104	Y282F	possibly damaging	Het
Cul7	A	G	17: 46,655,710	D355G	probably benign	Het
Daxx	T	C	17: 33,912,253	Y385H	probably damaging	Het
Dnah2	A	C	11: 69,520,667		probably null	Het
Dscc1	CTGAATGAAT	CTGAAT	15: 55,080,176		probably benign	Het
Erc2	T	A	14: 28,302,898	M578K	probably benign	Het
Evc	T	A	5: 37,323,700	H267L	possibly damaging	Het
Exosc10	A	C	4: 148,581,786	Q837P	possibly damaging	Het
Fasn	G	A	11: 120,815,419	T1033I	probably damaging	Het
Fat1	C	A	8: 45,025,484	Y2522*	probably null	Het
Fbxw8	G	A	5: 118,065,785		probably benign	Het
Fyn	A	G	10: 39,532,124	D321G	possibly damaging	Het
Gm14685	G	T	X: 73,127,655	G218C	probably damaging	Het
Gm156	A	G	6: 129,771,740	S105P	probably damaging	Het
Grm6	G	A	11: 50,857,256	V398M	probably damaging	Het
Gtpbp1	T	A	15: 79,719,021		probably null	Het
Hnf1a	A	G	5: 114,970,537	V103A	probably damaging	Het
Iqgap2	C	T	13: 95,646,805	V1288I	probably benign	Het
Irx5	A	G	8: 92,359,886	D199G	probably damaging	Het
Krt9	G	T	11: 100,188,369	C732*	probably null	Het
Lifr	T	C	15: 7,190,618	S910P	probably damaging	Het
Lrig1	G	A	6: 94,627,987	A209V	possibly damaging	Het
Lrrk1	T	A	7: 66,302,671	R506*	probably null	Het
Lyst	T	A	13: 13,650,375	I1525K	possibly damaging	Het
Mad2l1	C	T	6: 66,539,842	Q173*	probably null	Het
Mcoln1	T	A	8: 3,512,861	I524N	probably damaging	Het
Mmp3	A	T	9: 7,446,967	D49V	possibly damaging	Het
Morc3	A	T	16: 93,853,855	N321I	probably damaging	Het
Mrpl48	T	C	7: 100,546,488		probably benign	Het
Myo6	T	A	9: 80,307,679	D1231E	probably damaging	Het
Nlrc4	A	G	17: 74,446,413	I325T	probably benign	Het
Olfr1079	A	G	2: 86,538,558	V117A	probably benign	Het
Olfr1314	A	T	2: 112,092,593	M36K	probably benign	Het
Olfr348	A	T	2: 36,787,346	I274F	probably damaging	Het
Olfr699	T	C	7: 106,790,416	Y195C	possibly damaging	Het
Olfr894	C	G	9: 38,219,380	P183A	probably damaging	Het
Parvg	T	A	15: 84,334,631	S230T	possibly damaging	Het
Pcca	T	C	14: 122,616,818	I118T	probably damaging	Het
Pde6a	A	G	18: 61,232,860	N219S	possibly damaging	Het
Phldb1	G	T	9: 44,701,618	P935Q	possibly damaging	Het
Plppr5	T	C	3: 117,662,612	S261P	probably damaging	Het
Ppl	T	C	16: 5,104,765	N260S	probably benign	Het
Ppp1r3e	A	T	14: 54,876,425	H263Q	probably benign	Het
Ppp3cb	T	C	14: 20,509,499		probably null	Het
Ppt2	A	T	17: 34,623,101	D185E	probably benign	Het
Prr27	A	T	5: 87,850,741		probably benign	Het
Ptcd3	A	T	6: 71,893,495	V327E	probably damaging	Het
Rsf1	GCG	GCGACG	7: 97,579,907		probably benign	Het
Rtp1	A	T	16: 23,431,220	M112L	probably benign	Het
Slc22a5	A	T	11: 53,869,314	L392Q	probably damaging	Het
Slc6a7	A	G	18: 60,996,692	I614T	probably benign	Het
Slu7	C	A	11: 43,438,217	P89T	possibly damaging	Het
Smarcc2	T	C	10: 128,482,192	V618A	probably benign	Het
Sorl1	C	T	9: 42,041,073	R729Q	probably damaging	Het
Sptbn2	T	C	19: 4,744,246	F1493L	possibly damaging	Het
Sulf1	C	T	1: 12,848,350	T66I	probably damaging	Het
Tgtp2	A	G	11: 49,059,338	Y136H	probably damaging	Het
Tmem117	T	C	15: 94,638,361	F92S	probably damaging	Het
Tmprss9	T	A	10: 80,895,100	V820E	probably benign	Het
Tpcn2	A	G	7: 145,268,911	Y266H	probably damaging	Het
Trat1	A	G	16: 48,734,941	S143P	probably benign	Het
Vmn1r49	T	A	6: 90,072,316	R235W	probably damaging	Het
Vmn1r71	A	T	7: 10,748,648	C38S	probably benign	Het
Vmn2r6	T	A	3: 64,556,469	T315S	probably damaging	Het
Wdr36	A	G	18: 32,852,968	D575G	possibly damaging	Het
Zfp292	G	T	4: 34,805,397	A2549E	possibly damaging	Het
Zfp354a	A	T	11: 51,070,246	H426L	probably damaging	Het
Zfp407	C	T	18: 84,559,773	A1072T	probably benign	Het
Zfp648	T	A	1: 154,205,373	I426N	probably damaging	Het
Zfp72	T	C	13: 74,372,617	N114S	probably benign	Het

Other mutations in Hsp90aa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02056:Hsp90aa1	APN	12	110694015	unclassified	probably benign
IGL02243:Hsp90aa1	APN	12	110695091	missense	probably damaging	1.00
IGL02865:Hsp90aa1	APN	12	110693082	missense	probably benign	0.11
IGL02965:Hsp90aa1	APN	12	110695679	start codon destroyed	probably null	0.95
R0827:Hsp90aa1	UTSW	12	110692695	missense	probably benign	0.38
R1331:Hsp90aa1	UTSW	12	110692820	missense	probably damaging	1.00
R2039:Hsp90aa1	UTSW	12	110693782	missense	probably damaging	1.00
R2082:Hsp90aa1	UTSW	12	110692827	missense	probably damaging	1.00
R2102:Hsp90aa1	UTSW	12	110694132	missense	probably damaging	0.99
R2169:Hsp90aa1	UTSW	12	110692734	missense	probably damaging	0.99
R2194:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2194:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2359:Hsp90aa1	UTSW	12	110694569	critical splice donor site	probably null
R2364:Hsp90aa1	UTSW	12	110692753	missense	probably damaging	0.99
R2393:Hsp90aa1	UTSW	12	110693406	missense	probably damaging	1.00
R2398:Hsp90aa1	UTSW	12	110692321	missense	possibly damaging	0.86
R2435:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2435:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2924:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2924:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2925:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2925:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3176:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3176:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3177:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3177:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3276:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3276:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3277:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3277:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3615:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3615:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3616:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3616:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R4033:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R4033:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R4815:Hsp90aa1	UTSW	12	110695226	missense	possibly damaging	0.45
R4932:Hsp90aa1	UTSW	12	110693717	missense	probably damaging	1.00
R5117:Hsp90aa1	UTSW	12	110695264	missense	possibly damaging	0.71
R5555:Hsp90aa1	UTSW	12	110692734	missense	probably damaging	1.00
R6382:Hsp90aa1	UTSW	12	110695517	critical splice donor site	probably null
R7024:Hsp90aa1	UTSW	12	110694112	missense	possibly damaging	0.46
R7324:Hsp90aa1	UTSW	12	110695225	missense	unknown
R7447:Hsp90aa1	UTSW	12	110692128	missense	possibly damaging	0.94
R7526:Hsp90aa1	UTSW	12	110695294	missense	unknown
R7732:Hsp90aa1	UTSW	12	110693418	missense	probably damaging	1.00
R8155:Hsp90aa1	UTSW	12	110695394	missense	unknown
R9004:Hsp90aa1	UTSW	12	110692611	missense	probably damaging	0.99
R9145:Hsp90aa1	UTSW	12	110696250	critical splice donor site	probably null
Z1177:Hsp90aa1	UTSW	12	110693466	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGATTGATGTGCAGCTCCTTCCCC -3'
(R):5'- CCGCATTCTGAAATGAGGTCATCCC -3'

Sequencing Primer
(F):5'- CGTAACGGATTTTATCCAGAGCC -3'
(R):5'- GAAATGAGGTCATCCCTTTGTC -3'

Posted On

2014-04-13