Incidental Mutation 'R1498:Iqgap2'
ID169067
Institutional Source Beutler Lab
Gene Symbol Iqgap2
Ensembl Gene ENSMUSG00000021676
Gene NameIQ motif containing GTPase activating protein 2
Synonyms4933417J23Rik
MMRRC Submission 039549-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1498 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location95627177-95891922 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 95646805 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1288 (V1288I)
Ref Sequence ENSEMBL: ENSMUSP00000067685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068603]
Predicted Effect probably benign
Transcript: ENSMUST00000068603
AA Change: V1288I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000067685
Gene: ENSMUSG00000021676
AA Change: V1288I

DomainStartEndE-ValueType
CH 43 152 3.32e-16 SMART
coiled coil region 253 276 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
IQ 689 711 1.38e-4 SMART
IQ 719 741 7.36e0 SMART
IQ 749 771 2.43e1 SMART
coiled coil region 799 828 N/A INTRINSIC
RasGAP 905 1258 2.6e-120 SMART
Pfam:RasGAP_C 1367 1498 3.2e-40 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 97% (83/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains three IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display reduced survival with increased incidence of hepatocellular carcinomas, increased hepatocyte apoptosis, and hepatocyte mitochondrial abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,931,371 H435R probably benign Het
Acly A G 11: 100,483,801 S799P probably benign Het
Acvr1b T C 15: 101,194,010 F57S probably benign Het
Adamts5 T A 16: 85,900,102 T56S possibly damaging Het
Adrb2 T C 18: 62,178,933 T274A probably damaging Het
Agr3 A T 12: 35,934,380 probably null Het
Ankrd6 A G 4: 32,810,289 M405T probably benign Het
Aqp5 T C 15: 99,593,247 I60T probably damaging Het
Arf5 G T 6: 28,426,154 R180L probably benign Het
Asap3 A G 4: 136,239,194 N528D probably benign Het
Atmin G A 8: 116,954,801 E180K probably benign Het
Bcl11a A T 11: 24,164,005 E449D probably damaging Het
Cep128 A T 12: 91,366,417 F25I probably benign Het
Cfp GCAC GC X: 20,929,666 probably null Het
Chpt1 T A 10: 88,477,104 Y282F possibly damaging Het
Cul7 A G 17: 46,655,710 D355G probably benign Het
Daxx T C 17: 33,912,253 Y385H probably damaging Het
Dnah2 A C 11: 69,520,667 probably null Het
Dscc1 CTGAATGAAT CTGAAT 15: 55,080,176 probably benign Het
Erc2 T A 14: 28,302,898 M578K probably benign Het
Evc T A 5: 37,323,700 H267L possibly damaging Het
Exosc10 A C 4: 148,581,786 Q837P possibly damaging Het
Fasn G A 11: 120,815,419 T1033I probably damaging Het
Fat1 C A 8: 45,025,484 Y2522* probably null Het
Fbxw8 G A 5: 118,065,785 probably benign Het
Fyn A G 10: 39,532,124 D321G possibly damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm156 A G 6: 129,771,740 S105P probably damaging Het
Grm6 G A 11: 50,857,256 V398M probably damaging Het
Gtpbp1 T A 15: 79,719,021 probably null Het
Hnf1a A G 5: 114,970,537 V103A probably damaging Het
Hsp90aa1 A T 12: 110,695,688 probably null Het
Irx5 A G 8: 92,359,886 D199G probably damaging Het
Krt9 G T 11: 100,188,369 C732* probably null Het
Lifr T C 15: 7,190,618 S910P probably damaging Het
Lrig1 G A 6: 94,627,987 A209V possibly damaging Het
Lrrk1 T A 7: 66,302,671 R506* probably null Het
Lyst T A 13: 13,650,375 I1525K possibly damaging Het
Mad2l1 C T 6: 66,539,842 Q173* probably null Het
Mcoln1 T A 8: 3,512,861 I524N probably damaging Het
Mmp3 A T 9: 7,446,967 D49V possibly damaging Het
Morc3 A T 16: 93,853,855 N321I probably damaging Het
Mrpl48 T C 7: 100,546,488 probably benign Het
Myo6 T A 9: 80,307,679 D1231E probably damaging Het
Nlrc4 A G 17: 74,446,413 I325T probably benign Het
Olfr1079 A G 2: 86,538,558 V117A probably benign Het
Olfr1314 A T 2: 112,092,593 M36K probably benign Het
Olfr348 A T 2: 36,787,346 I274F probably damaging Het
Olfr699 T C 7: 106,790,416 Y195C possibly damaging Het
Olfr894 C G 9: 38,219,380 P183A probably damaging Het
Parvg T A 15: 84,334,631 S230T possibly damaging Het
Pcca T C 14: 122,616,818 I118T probably damaging Het
Pde6a A G 18: 61,232,860 N219S possibly damaging Het
Phldb1 G T 9: 44,701,618 P935Q possibly damaging Het
Plppr5 T C 3: 117,662,612 S261P probably damaging Het
Ppl T C 16: 5,104,765 N260S probably benign Het
Ppp1r3e A T 14: 54,876,425 H263Q probably benign Het
Ppp3cb T C 14: 20,509,499 probably null Het
Ppt2 A T 17: 34,623,101 D185E probably benign Het
Prr27 A T 5: 87,850,741 probably benign Het
Ptcd3 A T 6: 71,893,495 V327E probably damaging Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Rtp1 A T 16: 23,431,220 M112L probably benign Het
Slc22a5 A T 11: 53,869,314 L392Q probably damaging Het
Slc6a7 A G 18: 60,996,692 I614T probably benign Het
Slu7 C A 11: 43,438,217 P89T possibly damaging Het
Smarcc2 T C 10: 128,482,192 V618A probably benign Het
Sorl1 C T 9: 42,041,073 R729Q probably damaging Het
Sptbn2 T C 19: 4,744,246 F1493L possibly damaging Het
Sulf1 C T 1: 12,848,350 T66I probably damaging Het
Tgtp2 A G 11: 49,059,338 Y136H probably damaging Het
Tmem117 T C 15: 94,638,361 F92S probably damaging Het
Tmprss9 T A 10: 80,895,100 V820E probably benign Het
Tpcn2 A G 7: 145,268,911 Y266H probably damaging Het
Trat1 A G 16: 48,734,941 S143P probably benign Het
Vmn1r49 T A 6: 90,072,316 R235W probably damaging Het
Vmn1r71 A T 7: 10,748,648 C38S probably benign Het
Vmn2r6 T A 3: 64,556,469 T315S probably damaging Het
Wdr36 A G 18: 32,852,968 D575G possibly damaging Het
Zfp292 G T 4: 34,805,397 A2549E possibly damaging Het
Zfp354a A T 11: 51,070,246 H426L probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp648 T A 1: 154,205,373 I426N probably damaging Het
Zfp72 T C 13: 74,372,617 N114S probably benign Het
Other mutations in Iqgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Iqgap2 APN 13 95657944 splice site probably benign
IGL01968:Iqgap2 APN 13 95635582 missense possibly damaging 0.80
IGL02049:Iqgap2 APN 13 95675405 splice site probably benign
IGL02195:Iqgap2 APN 13 95661734 splice site probably benign
IGL02387:Iqgap2 APN 13 95689701 missense probably benign 0.00
IGL02634:Iqgap2 APN 13 95628114 missense probably damaging 1.00
IGL02666:Iqgap2 APN 13 95628056 missense probably damaging 1.00
IGL02685:Iqgap2 APN 13 95671404 missense probably damaging 1.00
IGL02927:Iqgap2 APN 13 95724676 missense possibly damaging 0.62
IGL02943:Iqgap2 APN 13 95661735 splice site probably benign
IGL03167:Iqgap2 APN 13 95684898 missense probably benign 0.34
IGL03169:Iqgap2 APN 13 95731277 splice site probably null
IGL03293:Iqgap2 APN 13 95731434 missense probably damaging 1.00
R0257:Iqgap2 UTSW 13 95724544 critical splice donor site probably null
R0335:Iqgap2 UTSW 13 95635633 missense probably damaging 0.99
R0360:Iqgap2 UTSW 13 95731275 splice site probably benign
R0364:Iqgap2 UTSW 13 95731275 splice site probably benign
R0419:Iqgap2 UTSW 13 95689699 critical splice donor site probably null
R1229:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1290:Iqgap2 UTSW 13 95668513 missense probably damaging 1.00
R1397:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1513:Iqgap2 UTSW 13 95630010 missense probably damaging 1.00
R1630:Iqgap2 UTSW 13 95689785 missense probably benign
R2088:Iqgap2 UTSW 13 95891663 critical splice donor site probably null
R2928:Iqgap2 UTSW 13 95682236 missense probably benign
R3026:Iqgap2 UTSW 13 95673056 critical splice acceptor site probably null
R3720:Iqgap2 UTSW 13 95668528 splice site probably null
R3846:Iqgap2 UTSW 13 95673678 splice site probably benign
R4056:Iqgap2 UTSW 13 95750033 missense probably damaging 1.00
R4077:Iqgap2 UTSW 13 95657867 missense probably damaging 1.00
R4353:Iqgap2 UTSW 13 95671396 missense probably damaging 1.00
R4517:Iqgap2 UTSW 13 95664061 critical splice donor site probably null
R4628:Iqgap2 UTSW 13 95763329 missense probably benign 0.17
R4686:Iqgap2 UTSW 13 95721609 missense probably damaging 0.98
R4724:Iqgap2 UTSW 13 95635497 missense possibly damaging 0.73
R4826:Iqgap2 UTSW 13 95763275 missense probably damaging 1.00
R4847:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R4967:Iqgap2 UTSW 13 95630006 missense probably benign 0.00
R4973:Iqgap2 UTSW 13 95657797 splice site probably null
R5010:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R5086:Iqgap2 UTSW 13 95635580 missense probably benign 0.01
R5496:Iqgap2 UTSW 13 95630053 missense probably damaging 1.00
R5512:Iqgap2 UTSW 13 95675376 nonsense probably null
R5629:Iqgap2 UTSW 13 95632174 missense probably damaging 1.00
R5824:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5830:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5831:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5832:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5833:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5834:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5852:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5888:Iqgap2 UTSW 13 95635610 missense possibly damaging 0.89
R5889:Iqgap2 UTSW 13 95632042 missense probably benign 0.00
R6093:Iqgap2 UTSW 13 95628963 missense probably damaging 0.99
R6141:Iqgap2 UTSW 13 95721686 splice site probably null
R6404:Iqgap2 UTSW 13 95729477 missense probably benign 0.28
R6434:Iqgap2 UTSW 13 95682933 missense possibly damaging 0.85
R6648:Iqgap2 UTSW 13 95682211 missense probably benign 0.27
R6658:Iqgap2 UTSW 13 95660332 missense probably damaging 1.00
R6903:Iqgap2 UTSW 13 95661057 missense probably damaging 1.00
R7223:Iqgap2 UTSW 13 95628972 missense probably damaging 1.00
R7327:Iqgap2 UTSW 13 95635655 missense probably benign 0.00
R7371:Iqgap2 UTSW 13 95700338 splice site probably null
R7378:Iqgap2 UTSW 13 95732890 critical splice donor site probably null
R7441:Iqgap2 UTSW 13 95628076 missense probably benign 0.23
R7575:Iqgap2 UTSW 13 95661623 missense probably damaging 0.99
R7671:Iqgap2 UTSW 13 95628119 missense probably damaging 0.98
R7713:Iqgap2 UTSW 13 95731444 missense probably benign 0.01
R7806:Iqgap2 UTSW 13 95682257 missense probably benign 0.00
R7893:Iqgap2 UTSW 13 95689709 missense probably damaging 0.96
R8052:Iqgap2 UTSW 13 95657879 missense probably damaging 0.96
R8121:Iqgap2 UTSW 13 95724568 missense probably benign 0.00
R8261:Iqgap2 UTSW 13 95635570 missense probably damaging 1.00
R8301:Iqgap2 UTSW 13 95682151 critical splice donor site probably null
R8369:Iqgap2 UTSW 13 95661603 missense probably damaging 1.00
R8485:Iqgap2 UTSW 13 95660151 missense probably damaging 0.99
R8709:Iqgap2 UTSW 13 95660205 missense probably damaging 0.99
R8710:Iqgap2 UTSW 13 95660248 missense probably benign 0.24
R8737:Iqgap2 UTSW 13 95665750 missense probably damaging 1.00
X0066:Iqgap2 UTSW 13 95671383 missense probably damaging 0.98
Z1176:Iqgap2 UTSW 13 95731443 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GGAATGAGCATAAACCCAGTCTCTCAC -3'
(R):5'- CCAGTCCAGATGTCCTAGAATACGCAG -3'

Sequencing Primer
(F):5'- TATACTAACAACAAAGTTGGGCTGG -3'
(R):5'- TTATGAGGCCCGTAAATCTCC -3'
Posted On2014-04-13