Mutagenetix > Incidental Mutations

Incidental Mutation 'R1498:Adamts5'

169081

Institutional Source

Beutler Lab

Gene Symbol

Adamts5

Ensembl Gene

ENSMUSG00000022894

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)

Synonyms

9530092O11Rik, ADAM-TS5

MMRRC Submission

039549-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.198) question?

Stock #

R1498 (G1)

Quality Score

137

Status

Validated

Chromosome

Chromosomal Location

85856173-85901828 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 85900102 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 56 (T56S)

Ref Sequence

ENSEMBL: ENSMUSP00000023611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023611]

AlphaFold

Q9R001

Predicted Effect

possibly damaging
Transcript: ENSMUST00000023611
AA Change: T56S

PolyPhen 2 Score 0.628 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000023611
Gene: ENSMUSG00000022894
AA Change: T56S

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Pep_M12B_propep	41	182	9.1e-18	PFAM
low complexity region	226	232	N/A	INTRINSIC
Pfam:Reprolysin_5	265	450	2.1e-16	PFAM
Pfam:Reprolysin_4	265	472	4.8e-14	PFAM
Pfam:Reprolysin	267	476	4.6e-26	PFAM
Pfam:Reprolysin_2	286	466	3.7e-13	PFAM
Pfam:Reprolysin_3	288	421	6.9e-17	PFAM
Blast:ACR	477	555	4e-15	BLAST
low complexity region	556	566	N/A	INTRINSIC
TSP1	570	622	6.04e-13	SMART
Pfam:ADAM_spacer1	732	852	1.7e-35	PFAM
TSP1	878	926	7.12e-2	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.6%

Validation Efficiency

97% (83/86)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. Mice lacking the encoded protein are protected from surgery-induced osteoarthritis and antigen-induced arthritis. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit a significant reduction in cartilage degradation after induction of osteoarthritis whereas those homozygous for another show no affect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	A	G	6: 48,931,371	H435R	probably benign	Het
Acly	A	G	11: 100,483,801	S799P	probably benign	Het
Acvr1b	T	C	15: 101,194,010	F57S	probably benign	Het
Adrb2	T	C	18: 62,178,933	T274A	probably damaging	Het
Agr3	A	T	12: 35,934,380		probably null	Het
Ankrd6	A	G	4: 32,810,289	M405T	probably benign	Het
Aqp5	T	C	15: 99,593,247	I60T	probably damaging	Het
Arf5	G	T	6: 28,426,154	R180L	probably benign	Het
Asap3	A	G	4: 136,239,194	N528D	probably benign	Het
Atmin	G	A	8: 116,954,801	E180K	probably benign	Het
Bcl11a	A	T	11: 24,164,005	E449D	probably damaging	Het
Cep128	A	T	12: 91,366,417	F25I	probably benign	Het
Cfp	GCAC	GC	X: 20,929,666		probably null	Het
Chpt1	T	A	10: 88,477,104	Y282F	possibly damaging	Het
Cul7	A	G	17: 46,655,710	D355G	probably benign	Het
Daxx	T	C	17: 33,912,253	Y385H	probably damaging	Het
Dnah2	A	C	11: 69,520,667		probably null	Het
Dscc1	CTGAATGAAT	CTGAAT	15: 55,080,176		probably benign	Het
Erc2	T	A	14: 28,302,898	M578K	probably benign	Het
Evc	T	A	5: 37,323,700	H267L	possibly damaging	Het
Exosc10	A	C	4: 148,581,786	Q837P	possibly damaging	Het
Fasn	G	A	11: 120,815,419	T1033I	probably damaging	Het
Fat1	C	A	8: 45,025,484	Y2522*	probably null	Het
Fbxw8	G	A	5: 118,065,785		probably benign	Het
Fyn	A	G	10: 39,532,124	D321G	possibly damaging	Het
Gm14685	G	T	X: 73,127,655	G218C	probably damaging	Het
Gm156	A	G	6: 129,771,740	S105P	probably damaging	Het
Grm6	G	A	11: 50,857,256	V398M	probably damaging	Het
Gtpbp1	T	A	15: 79,719,021		probably null	Het
Hnf1a	A	G	5: 114,970,537	V103A	probably damaging	Het
Hsp90aa1	A	T	12: 110,695,688		probably null	Het
Iqgap2	C	T	13: 95,646,805	V1288I	probably benign	Het
Irx5	A	G	8: 92,359,886	D199G	probably damaging	Het
Krt9	G	T	11: 100,188,369	C732*	probably null	Het
Lifr	T	C	15: 7,190,618	S910P	probably damaging	Het
Lrig1	G	A	6: 94,627,987	A209V	possibly damaging	Het
Lrrk1	T	A	7: 66,302,671	R506*	probably null	Het
Lyst	T	A	13: 13,650,375	I1525K	possibly damaging	Het
Mad2l1	C	T	6: 66,539,842	Q173*	probably null	Het
Mcoln1	T	A	8: 3,512,861	I524N	probably damaging	Het
Mmp3	A	T	9: 7,446,967	D49V	possibly damaging	Het
Morc3	A	T	16: 93,853,855	N321I	probably damaging	Het
Mrpl48	T	C	7: 100,546,488		probably benign	Het
Myo6	T	A	9: 80,307,679	D1231E	probably damaging	Het
Nlrc4	A	G	17: 74,446,413	I325T	probably benign	Het
Olfr1079	A	G	2: 86,538,558	V117A	probably benign	Het
Olfr1314	A	T	2: 112,092,593	M36K	probably benign	Het
Olfr348	A	T	2: 36,787,346	I274F	probably damaging	Het
Olfr699	T	C	7: 106,790,416	Y195C	possibly damaging	Het
Olfr894	C	G	9: 38,219,380	P183A	probably damaging	Het
Parvg	T	A	15: 84,334,631	S230T	possibly damaging	Het
Pcca	T	C	14: 122,616,818	I118T	probably damaging	Het
Pde6a	A	G	18: 61,232,860	N219S	possibly damaging	Het
Phldb1	G	T	9: 44,701,618	P935Q	possibly damaging	Het
Plppr5	T	C	3: 117,662,612	S261P	probably damaging	Het
Ppl	T	C	16: 5,104,765	N260S	probably benign	Het
Ppp1r3e	A	T	14: 54,876,425	H263Q	probably benign	Het
Ppp3cb	T	C	14: 20,509,499		probably null	Het
Ppt2	A	T	17: 34,623,101	D185E	probably benign	Het
Prr27	A	T	5: 87,850,741		probably benign	Het
Ptcd3	A	T	6: 71,893,495	V327E	probably damaging	Het
Rsf1	GCG	GCGACG	7: 97,579,907		probably benign	Het
Rtp1	A	T	16: 23,431,220	M112L	probably benign	Het
Slc22a5	A	T	11: 53,869,314	L392Q	probably damaging	Het
Slc6a7	A	G	18: 60,996,692	I614T	probably benign	Het
Slu7	C	A	11: 43,438,217	P89T	possibly damaging	Het
Smarcc2	T	C	10: 128,482,192	V618A	probably benign	Het
Sorl1	C	T	9: 42,041,073	R729Q	probably damaging	Het
Sptbn2	T	C	19: 4,744,246	F1493L	possibly damaging	Het
Sulf1	C	T	1: 12,848,350	T66I	probably damaging	Het
Tgtp2	A	G	11: 49,059,338	Y136H	probably damaging	Het
Tmem117	T	C	15: 94,638,361	F92S	probably damaging	Het
Tmprss9	T	A	10: 80,895,100	V820E	probably benign	Het
Tpcn2	A	G	7: 145,268,911	Y266H	probably damaging	Het
Trat1	A	G	16: 48,734,941	S143P	probably benign	Het
Vmn1r49	T	A	6: 90,072,316	R235W	probably damaging	Het
Vmn1r71	A	T	7: 10,748,648	C38S	probably benign	Het
Vmn2r6	T	A	3: 64,556,469	T315S	probably damaging	Het
Wdr36	A	G	18: 32,852,968	D575G	possibly damaging	Het
Zfp292	G	T	4: 34,805,397	A2549E	possibly damaging	Het
Zfp354a	A	T	11: 51,070,246	H426L	probably damaging	Het
Zfp407	C	T	18: 84,559,773	A1072T	probably benign	Het
Zfp648	T	A	1: 154,205,373	I426N	probably damaging	Het
Zfp72	T	C	13: 74,372,617	N114S	probably benign	Het

Other mutations in Adamts5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01063:Adamts5	APN	16	85899834	missense	probably damaging	1.00
IGL01070:Adamts5	APN	16	85863133	missense	probably damaging	1.00
IGL01321:Adamts5	APN	16	85899475	missense	probably benign	0.03
IGL01616:Adamts5	APN	16	85887814	splice site	probably null
IGL02551:Adamts5	APN	16	85870038	missense	possibly damaging	0.71
IGL03263:Adamts5	APN	16	85869942	missense	probably damaging	0.99
IGL03295:Adamts5	APN	16	85877945	missense	probably damaging	1.00
IGL03393:Adamts5	APN	16	85868195	missense	probably damaging	0.99
IGL03403:Adamts5	APN	16	85863014	missense	probably damaging	0.97
R0414:Adamts5	UTSW	16	85877906	missense	probably damaging	1.00
R0419:Adamts5	UTSW	16	85866642	missense	probably benign	0.00
R0539:Adamts5	UTSW	16	85868692	missense	probably damaging	1.00
R0570:Adamts5	UTSW	16	85899247	missense	probably damaging	1.00
R0574:Adamts5	UTSW	16	85899484	missense	probably damaging	0.99
R0669:Adamts5	UTSW	16	85899726	missense	probably benign	0.45
R1454:Adamts5	UTSW	16	85869993	missense	possibly damaging	0.88
R1729:Adamts5	UTSW	16	85877915	nonsense	probably null
R1753:Adamts5	UTSW	16	85899352	missense	probably damaging	1.00
R1784:Adamts5	UTSW	16	85877915	nonsense	probably null
R1906:Adamts5	UTSW	16	85868685	nonsense	probably null
R1946:Adamts5	UTSW	16	85899243	missense	probably damaging	1.00
R2180:Adamts5	UTSW	16	85887924	missense	probably damaging	1.00
R2223:Adamts5	UTSW	16	85899306	missense	probably damaging	1.00
R2366:Adamts5	UTSW	16	85862758	missense	probably damaging	1.00
R3889:Adamts5	UTSW	16	85868121	missense	probably damaging	1.00
R4214:Adamts5	UTSW	16	85868643	missense	probably damaging	1.00
R4909:Adamts5	UTSW	16	85900066	nonsense	probably null
R5119:Adamts5	UTSW	16	85899578	missense	probably benign	0.00
R5230:Adamts5	UTSW	16	85870068	missense	probably damaging	0.97
R5452:Adamts5	UTSW	16	85869912	critical splice donor site	probably benign
R5652:Adamts5	UTSW	16	85899268	missense	probably damaging	1.00
R5831:Adamts5	UTSW	16	85868118	missense	probably damaging	1.00
R6045:Adamts5	UTSW	16	85899300	missense	probably damaging	0.99
R6259:Adamts5	UTSW	16	85899753	missense	probably benign	0.03
R6384:Adamts5	UTSW	16	85862828	missense	probably benign	0.00
R6724:Adamts5	UTSW	16	85868557	missense	probably benign	0.06
R6829:Adamts5	UTSW	16	85870071	missense	possibly damaging	0.52
R7066:Adamts5	UTSW	16	85862764	missense	probably damaging	1.00
R7256:Adamts5	UTSW	16	85863035	missense	probably damaging	1.00
R7293:Adamts5	UTSW	16	85899945	missense	probably benign	0.10
R7298:Adamts5	UTSW	16	85899918	missense	probably benign	0.35
R7384:Adamts5	UTSW	16	85899826	missense	probably benign	0.02
R7452:Adamts5	UTSW	16	85877981	missense	probably benign	0.00
R7727:Adamts5	UTSW	16	85899966	missense	probably damaging	1.00
R7785:Adamts5	UTSW	16	85863004	missense	probably damaging	0.99
R7894:Adamts5	UTSW	16	85877920	nonsense	probably null
R8111:Adamts5	UTSW	16	85899315	missense	probably damaging	1.00
R8370:Adamts5	UTSW	16	85899993	missense	possibly damaging	0.74
R8413:Adamts5	UTSW	16	85866618	critical splice donor site	probably null
R8505:Adamts5	UTSW	16	85900056	missense	probably benign	0.42
R8804:Adamts5	UTSW	16	85869912	critical splice donor site	probably benign
R9209:Adamts5	UTSW	16	85870083	missense	probably damaging	1.00
X0062:Adamts5	UTSW	16	85863157	missense	probably damaging	1.00
Z1177:Adamts5	UTSW	16	85870074	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCAGTAACGATGCTACCAGCAGC -3'
(R):5'- ACTTGACTCAACCTTGCACGCC -3'

Sequencing Primer
(F):5'- AGCAGCACCCACTGTGTC -3'
(R):5'- GCATCCAGCTAGACTCAGTCG -3'

Posted On

2014-04-13