Mutagenetix > Incidental Mutation

Incidental Mutation 'R1505:Osbpl6'

169099

Institutional Source

Beutler Lab

Gene Symbol

Osbpl6

Ensembl Gene

ENSMUSG00000042359

Gene Name

oxysterol binding protein-like 6

Synonyms

1110062M20Rik, ORP-6

MMRRC Submission

040868-MU

Accession Numbers

Genbank: NM_145525; MGI: 2139014

Is this an essential gene?

Possibly non essential (E-score: 0.482) question?

Stock #

R1505 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

76406508-76600647 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 76579242 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 483 (S483P)

Ref Sequence

ENSEMBL: ENSMUSP00000107561 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077972] [ENSMUST00000111929] [ENSMUST00000111930] [ENSMUST00000184442]

AlphaFold

Q8BXR9

Predicted Effect

probably damaging
Transcript: ENSMUST00000077972
AA Change: S522P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000077123
Gene: ENSMUSG00000042359
AA Change: S522P

Domain	Start	End	E-Value	Type
low complexity region	14	35	N/A	INTRINSIC
PH	87	183	3.65e-7	SMART
low complexity region	200	211	N/A	INTRINSIC
coiled coil region	255	285	N/A	INTRINSIC
low complexity region	537	550	N/A	INTRINSIC
Pfam:Oxysterol_BP	603	951	1.4e-135	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111929
AA Change: S514P

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000107560
Gene: ENSMUSG00000042359
AA Change: S514P

Domain	Start	End	E-Value	Type
low complexity region	14	35	N/A	INTRINSIC
PH	87	183	3.65e-7	SMART
low complexity region	200	211	N/A	INTRINSIC
coiled coil region	255	285	N/A	INTRINSIC
coiled coil region	441	472	N/A	INTRINSIC
low complexity region	529	542	N/A	INTRINSIC
Pfam:Oxysterol_BP	595	944	1.1e-139	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000111930
AA Change: S483P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107561
Gene: ENSMUSG00000042359
AA Change: S483P

Domain	Start	End	E-Value	Type
low complexity region	14	35	N/A	INTRINSIC
PH	87	183	3.65e-7	SMART
low complexity region	200	211	N/A	INTRINSIC
coiled coil region	255	285	N/A	INTRINSIC
coiled coil region	410	441	N/A	INTRINSIC
low complexity region	498	511	N/A	INTRINSIC
Pfam:Oxysterol_BP	564	913	1e-139	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124601

Predicted Effect

probably damaging
Transcript: ENSMUST00000184442
AA Change: S376P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139363
Gene: ENSMUSG00000042359
AA Change: S376P

Domain	Start	End	E-Value	Type
Blast:PH	1	70	8e-41	BLAST
low complexity region	87	98	N/A	INTRINSIC
coiled coil region	142	172	N/A	INTRINSIC
coiled coil region	303	334	N/A	INTRINSIC
low complexity region	391	404	N/A	INTRINSIC
Pfam:Oxysterol_BP	457	794	2.6e-135	PFAM

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.5%
20x: 86.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. Transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg3	T	A	5: 104,951,565	R444W	probably damaging	Het
Adnp	A	G	2: 168,183,741	S545P	possibly damaging	Het
Ankrd17	T	C	5: 90,300,026	R219G	possibly damaging	Het
Ap2m1	C	G	16: 20,542,697	P372A	probably benign	Het
Calml3	T	A	13: 3,804,071	T45S	probably benign	Het
Casp8	A	G	1: 58,828,922	E174G	probably damaging	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Cfap221	A	C	1: 119,953,628	L368R	probably benign	Het
Chd9	A	G	8: 91,006,495		probably null	Het
Cnot1	A	T	8: 95,728,667	I2035N	probably damaging	Het
Cyp2c67	T	C	19: 39,648,964	R23G	probably benign	Het
Dnah10	A	C	5: 124,754,239	H777P	possibly damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam162b	G	A	10: 51,587,202	A123V	probably damaging	Het
Golgb1	T	A	16: 36,919,643	N2781K	possibly damaging	Het
Hs2st1	C	A	3: 144,434,561	R333L	probably benign	Het
Kmt2e	A	G	5: 23,500,535	H1319R	probably null	Het
Necab1	A	T	4: 14,960,047	M300K	probably benign	Het
Ntrk3	T	A	7: 78,460,524	I321F	probably damaging	Het
Olfr228	A	T	2: 86,483,213	H176Q	possibly damaging	Het
Olfr484	A	G	7: 108,124,993	V90A	probably benign	Het
Olfr860	A	T	9: 19,845,788	M277K	probably benign	Het
Olfr965	A	G	9: 39,719,478	N84D	probably damaging	Het
Pcdhb17	A	C	18: 37,486,822	N555T	probably damaging	Het
Pdgfc	G	A	3: 81,209,236	R299H	possibly damaging	Het
Ptpn7	A	T	1: 135,134,564	T83S	probably benign	Het
Rapgef5	T	C	12: 117,688,619	V79A	possibly damaging	Het
Rexo5	T	A	7: 119,799,603	C54*	probably null	Het
Riok3	A	G	18: 12,152,878	K418R	probably benign	Het
Robo4	G	A	9: 37,403,227	G170D	probably damaging	Het
Rpl8	A	G	15: 76,904,410	D33G	possibly damaging	Het
Rspo2	T	C	15: 43,075,843	T184A	probably damaging	Het
Ryr2	A	T	13: 11,554,592	M4942K	possibly damaging	Het
Sel1l	T	C	12: 91,813,962	Y585C	probably damaging	Het
Slc25a11	G	T	11: 70,646,824	D13E	probably benign	Het
Slc5a6	G	T	5: 31,037,111	H584N	probably benign	Het
Snrpf	A	G	10: 93,583,519	V69A	possibly damaging	Het
Sorbs3	T	A	14: 70,190,802	K475*	probably null	Het
Speg	G	A	1: 75,375,542	V35I	probably benign	Het
Tlk2	T	G	11: 105,260,295	V468G	probably damaging	Het
Trim6	T	A	7: 104,232,564	W341R	probably damaging	Het
Ttll5	T	A	12: 85,879,410	I326N	probably damaging	Het
Vipas39	T	C	12: 87,246,160	Y318C	probably damaging	Het
Vmn1r185	T	A	7: 26,611,478	I201F	probably damaging	Het
Vwce	A	G	19: 10,664,244	H778R	probably benign	Het
Zbtb14	C	G	17: 69,387,764	I152M	probably benign	Het

Other mutations in Osbpl6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00391:Osbpl6	APN	2	76590439	missense	probably damaging	1.00
IGL01109:Osbpl6	APN	2	76549527	missense	probably damaging	1.00
IGL01288:Osbpl6	APN	2	76564823	missense	probably damaging	0.98
IGL01717:Osbpl6	APN	2	76588594	missense	probably damaging	1.00
IGL02146:Osbpl6	APN	2	76549750	missense	possibly damaging	0.90
IGL02597:Osbpl6	APN	2	76555974	nonsense	probably null
IGL02652:Osbpl6	APN	2	76593454	missense	probably damaging	1.00
IGL02867:Osbpl6	APN	2	76595870	splice site	probably benign
IGL03143:Osbpl6	APN	2	76548372	missense	probably damaging	1.00
3-1:Osbpl6	UTSW	2	76586151	missense	probably damaging	1.00
R0085:Osbpl6	UTSW	2	76593414	missense	probably benign	0.30
R0201:Osbpl6	UTSW	2	76546042	missense	possibly damaging	0.92
R0573:Osbpl6	UTSW	2	76590391	missense	probably damaging	1.00
R0644:Osbpl6	UTSW	2	76594840	missense	probably damaging	1.00
R0855:Osbpl6	UTSW	2	76585133	missense	probably damaging	1.00
R0855:Osbpl6	UTSW	2	76591839	missense	probably damaging	1.00
R1017:Osbpl6	UTSW	2	76549719	missense	probably damaging	1.00
R1459:Osbpl6	UTSW	2	76555065	missense	probably benign	0.01
R1588:Osbpl6	UTSW	2	76579216	missense	probably benign
R1786:Osbpl6	UTSW	2	76586214	missense	probably damaging	1.00
R1863:Osbpl6	UTSW	2	76585058	missense	probably damaging	1.00
R2131:Osbpl6	UTSW	2	76586214	missense	probably damaging	1.00
R2132:Osbpl6	UTSW	2	76586214	missense	probably damaging	1.00
R2133:Osbpl6	UTSW	2	76586214	missense	probably damaging	1.00
R2233:Osbpl6	UTSW	2	76586769	missense	probably damaging	0.99
R2235:Osbpl6	UTSW	2	76586769	missense	probably damaging	0.99
R2256:Osbpl6	UTSW	2	76584474	missense	probably damaging	1.00
R2294:Osbpl6	UTSW	2	76577079	missense	possibly damaging	0.81
R3023:Osbpl6	UTSW	2	76586733	missense	probably damaging	1.00
R4192:Osbpl6	UTSW	2	76585229	missense	probably damaging	1.00
R4544:Osbpl6	UTSW	2	76584492	missense	possibly damaging	0.84
R4546:Osbpl6	UTSW	2	76584492	missense	possibly damaging	0.84
R4664:Osbpl6	UTSW	2	76568208	missense	probably benign	0.02
R4764:Osbpl6	UTSW	2	76546000	missense	probably damaging	1.00
R4884:Osbpl6	UTSW	2	76549539	missense	probably damaging	1.00
R5080:Osbpl6	UTSW	2	76524085	missense	probably benign	0.31
R5430:Osbpl6	UTSW	2	76586138	missense	probably damaging	1.00
R5614:Osbpl6	UTSW	2	76568109	missense	probably damaging	1.00
R5807:Osbpl6	UTSW	2	76584513	missense	probably damaging	0.98
R5956:Osbpl6	UTSW	2	76549512	missense	probably damaging	1.00
R6394:Osbpl6	UTSW	2	76555954	missense	probably benign	0.00
R6430:Osbpl6	UTSW	2	76579276	missense	probably damaging	1.00
R6450:Osbpl6	UTSW	2	76564830	missense	possibly damaging	0.90
R7116:Osbpl6	UTSW	2	76595881	missense	probably benign	0.06
R7385:Osbpl6	UTSW	2	76549450	missense	probably damaging	1.00
R7422:Osbpl6	UTSW	2	76593386	missense	probably damaging	1.00
R7561:Osbpl6	UTSW	2	76586154	missense	probably damaging	1.00
R7829:Osbpl6	UTSW	2	76593387	missense	probably damaging	1.00
R7921:Osbpl6	UTSW	2	76585097	missense	probably damaging	1.00
R8183:Osbpl6	UTSW	2	76585060	missense	probably damaging	1.00
R8219:Osbpl6	UTSW	2	76555903	missense	probably damaging	0.98
R8548:Osbpl6	UTSW	2	76579222	missense	possibly damaging	0.88
R8682:Osbpl6	UTSW	2	76577081	missense	probably benign	0.00
R8935:Osbpl6	UTSW	2	76549456	missense	possibly damaging	0.60
R9157:Osbpl6	UTSW	2	76552124	missense	probably benign	0.00
R9303:Osbpl6	UTSW	2	76548372	missense	probably damaging	1.00
R9305:Osbpl6	UTSW	2	76548372	missense	probably damaging	1.00
R9526:Osbpl6	UTSW	2	76585259	missense	probably damaging	0.98
R9536:Osbpl6	UTSW	2	76586210	missense	probably benign	0.00
R9564:Osbpl6	UTSW	2	76595977	missense	probably damaging	1.00
R9571:Osbpl6	UTSW	2	76594847	missense	probably benign	0.03
R9585:Osbpl6	UTSW	2	76524094	missense	probably benign
R9771:Osbpl6	UTSW	2	76593427	missense	possibly damaging	0.89
R9790:Osbpl6	UTSW	2	76555017	missense	probably damaging	1.00
R9791:Osbpl6	UTSW	2	76555017	missense	probably damaging	1.00
Z1177:Osbpl6	UTSW	2	76540179	missense	probably benign	0.01
Z31818:Osbpl6	UTSW	2	76555082	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCAACACCGCCGTCTTTCAAC -3'
(R):5'- ACAGCTCAGAGTCCCAGAGTCTTAG -3'

Sequencing Primer
(F):5'- TTTGGAGTCTCTAGACACAGCAG -3'
(R):5'- GGGCTTTACCCAAACTCTCAG -3'

Posted On

2014-04-13