Incidental Mutation 'R1505:Olfr228'
ID 169100
Institutional Source Beutler Lab
Gene Symbol Olfr228
Ensembl Gene ENSMUSG00000111772
Gene Name
Synonyms MOR189-3, GA_x6K02T0101M-139-669
MMRRC Submission 040868-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.120) question?
Stock # R1505 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 86481921-86487386 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 86483213 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 176 (H176Q)
Gene Model predicted gene model for transcript(s): [ENSMUST00000216534] [ENSMUST00000217292]
AlphaFold A0A1L1SR98
Predicted Effect possibly damaging
Transcript: ENSMUST00000099883
AA Change: H176Q

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097468
Gene: ENSMUSG00000075180
AA Change: H176Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1.5e-54 PFAM
Pfam:7tm_1 41 290 5.6e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215705
Predicted Effect possibly damaging
Transcript: ENSMUST00000216534
AA Change: H176Q

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217292
AA Change: H176Q

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 86.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T A 5: 104,951,565 R444W probably damaging Het
Adnp A G 2: 168,183,741 S545P possibly damaging Het
Ankrd17 T C 5: 90,300,026 R219G possibly damaging Het
Ap2m1 C G 16: 20,542,697 P372A probably benign Het
Calml3 T A 13: 3,804,071 T45S probably benign Het
Casp8 A G 1: 58,828,922 E174G probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap221 A C 1: 119,953,628 L368R probably benign Het
Chd9 A G 8: 91,006,495 probably null Het
Cnot1 A T 8: 95,728,667 I2035N probably damaging Het
Cyp2c67 T C 19: 39,648,964 R23G probably benign Het
Dnah10 A C 5: 124,754,239 H777P possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam162b G A 10: 51,587,202 A123V probably damaging Het
Golgb1 T A 16: 36,919,643 N2781K possibly damaging Het
Hs2st1 C A 3: 144,434,561 R333L probably benign Het
Kmt2e A G 5: 23,500,535 H1319R probably null Het
Necab1 A T 4: 14,960,047 M300K probably benign Het
Ntrk3 T A 7: 78,460,524 I321F probably damaging Het
Olfr484 A G 7: 108,124,993 V90A probably benign Het
Olfr860 A T 9: 19,845,788 M277K probably benign Het
Olfr965 A G 9: 39,719,478 N84D probably damaging Het
Osbpl6 T C 2: 76,579,242 S483P probably damaging Het
Pcdhb17 A C 18: 37,486,822 N555T probably damaging Het
Pdgfc G A 3: 81,209,236 R299H possibly damaging Het
Ptpn7 A T 1: 135,134,564 T83S probably benign Het
Rapgef5 T C 12: 117,688,619 V79A possibly damaging Het
Rexo5 T A 7: 119,799,603 C54* probably null Het
Riok3 A G 18: 12,152,878 K418R probably benign Het
Robo4 G A 9: 37,403,227 G170D probably damaging Het
Rpl8 A G 15: 76,904,410 D33G possibly damaging Het
Rspo2 T C 15: 43,075,843 T184A probably damaging Het
Ryr2 A T 13: 11,554,592 M4942K possibly damaging Het
Sel1l T C 12: 91,813,962 Y585C probably damaging Het
Slc25a11 G T 11: 70,646,824 D13E probably benign Het
Slc5a6 G T 5: 31,037,111 H584N probably benign Het
Snrpf A G 10: 93,583,519 V69A possibly damaging Het
Sorbs3 T A 14: 70,190,802 K475* probably null Het
Speg G A 1: 75,375,542 V35I probably benign Het
Tlk2 T G 11: 105,260,295 V468G probably damaging Het
Trim6 T A 7: 104,232,564 W341R probably damaging Het
Ttll5 T A 12: 85,879,410 I326N probably damaging Het
Vipas39 T C 12: 87,246,160 Y318C probably damaging Het
Vmn1r185 T A 7: 26,611,478 I201F probably damaging Het
Vwce A G 19: 10,664,244 H778R probably benign Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Other mutations in Olfr228
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Olfr228 APN 2 86483218 missense probably benign 0.05
IGL02136:Olfr228 APN 2 86483465 missense probably damaging 1.00
IGL02419:Olfr228 APN 2 86482915 missense probably damaging 0.99
IGL03008:Olfr228 APN 2 86483334 missense probably damaging 1.00
R0240:Olfr228 UTSW 2 86483386 missense possibly damaging 0.78
R0240:Olfr228 UTSW 2 86483386 missense possibly damaging 0.78
R1073:Olfr228 UTSW 2 86483640 missense probably damaging 0.98
R1163:Olfr228 UTSW 2 86483238 missense probably damaging 1.00
R1806:Olfr228 UTSW 2 86483139 missense probably damaging 0.99
R1940:Olfr228 UTSW 2 86483359 nonsense probably null
R3025:Olfr228 UTSW 2 86483739 start codon destroyed probably null 1.00
R3037:Olfr228 UTSW 2 86483643 missense probably damaging 0.96
R5156:Olfr228 UTSW 2 86483018 nonsense probably null
R6459:Olfr228 UTSW 2 86483229 missense probably benign 0.23
R6472:Olfr228 UTSW 2 86483190 nonsense probably null
R6493:Olfr228 UTSW 2 86483221 missense possibly damaging 0.59
R6880:Olfr228 UTSW 2 86483725 missense probably benign
R7283:Olfr228 UTSW 2 86483139 missense probably damaging 0.99
R8113:Olfr228 UTSW 2 86483068 missense probably damaging 1.00
R9799:Olfr228 UTSW 2 86483388 missense probably damaging 1.00
X0028:Olfr228 UTSW 2 86482890 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCCTGCCTTCAGCAGAGTTCATC -3'
(R):5'- AGACACCTCGCTACTACTGACCTTG -3'

Sequencing Primer
(F):5'- GAGTTCATCCTGAGAATAGCTCTGAG -3'
(R):5'- ACTGACCTTGGTTATTCAACAGC -3'
Posted On 2014-04-13