Incidental Mutation 'R1505:Necab1'
ID 169104
Institutional Source Beutler Lab
Gene Symbol Necab1
Ensembl Gene ENSMUSG00000040536
Gene Name N-terminal EF-hand calcium binding protein 1
Synonyms 1700003H21Rik, Efcbp1, NECAB1, STIP-1
MMRRC Submission 040868-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock # R1505 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 14952245-15149794 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 14960047 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 300 (M300K)
Ref Sequence ENSEMBL: ENSMUSP00000103908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041606] [ENSMUST00000108273]
AlphaFold Q8BG18
Predicted Effect probably benign
Transcript: ENSMUST00000041606
AA Change: M300K

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000038165
Gene: ENSMUSG00000040536
AA Change: M300K

low complexity region 4 25 N/A INTRINSIC
EFh 30 58 4.06e-2 SMART
EFh 64 92 6.56e0 SMART
coiled coil region 135 163 N/A INTRINSIC
coiled coil region 209 244 N/A INTRINSIC
Pfam:ABM 251 326 2.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108273
AA Change: M300K

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103908
Gene: ENSMUSG00000040536
AA Change: M300K

low complexity region 4 25 N/A INTRINSIC
EFh 30 58 4.06e-2 SMART
EFh 64 92 6.56e0 SMART
coiled coil region 135 163 N/A INTRINSIC
coiled coil region 209 244 N/A INTRINSIC
Pfam:ABM 251 326 2.4e-13 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 86.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T A 5: 104,951,565 R444W probably damaging Het
Adnp A G 2: 168,183,741 S545P possibly damaging Het
Ankrd17 T C 5: 90,300,026 R219G possibly damaging Het
Ap2m1 C G 16: 20,542,697 P372A probably benign Het
Calml3 T A 13: 3,804,071 T45S probably benign Het
Casp8 A G 1: 58,828,922 E174G probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap221 A C 1: 119,953,628 L368R probably benign Het
Chd9 A G 8: 91,006,495 probably null Het
Cnot1 A T 8: 95,728,667 I2035N probably damaging Het
Cyp2c67 T C 19: 39,648,964 R23G probably benign Het
Dnah10 A C 5: 124,754,239 H777P possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam162b G A 10: 51,587,202 A123V probably damaging Het
Golgb1 T A 16: 36,919,643 N2781K possibly damaging Het
Hs2st1 C A 3: 144,434,561 R333L probably benign Het
Kmt2e A G 5: 23,500,535 H1319R probably null Het
Ntrk3 T A 7: 78,460,524 I321F probably damaging Het
Olfr228 A T 2: 86,483,213 H176Q possibly damaging Het
Olfr484 A G 7: 108,124,993 V90A probably benign Het
Olfr860 A T 9: 19,845,788 M277K probably benign Het
Olfr965 A G 9: 39,719,478 N84D probably damaging Het
Osbpl6 T C 2: 76,579,242 S483P probably damaging Het
Pcdhb17 A C 18: 37,486,822 N555T probably damaging Het
Pdgfc G A 3: 81,209,236 R299H possibly damaging Het
Ptpn7 A T 1: 135,134,564 T83S probably benign Het
Rapgef5 T C 12: 117,688,619 V79A possibly damaging Het
Rexo5 T A 7: 119,799,603 C54* probably null Het
Riok3 A G 18: 12,152,878 K418R probably benign Het
Robo4 G A 9: 37,403,227 G170D probably damaging Het
Rpl8 A G 15: 76,904,410 D33G possibly damaging Het
Rspo2 T C 15: 43,075,843 T184A probably damaging Het
Ryr2 A T 13: 11,554,592 M4942K possibly damaging Het
Sel1l T C 12: 91,813,962 Y585C probably damaging Het
Slc25a11 G T 11: 70,646,824 D13E probably benign Het
Slc5a6 G T 5: 31,037,111 H584N probably benign Het
Snrpf A G 10: 93,583,519 V69A possibly damaging Het
Sorbs3 T A 14: 70,190,802 K475* probably null Het
Speg G A 1: 75,375,542 V35I probably benign Het
Tlk2 T G 11: 105,260,295 V468G probably damaging Het
Trim6 T A 7: 104,232,564 W341R probably damaging Het
Ttll5 T A 12: 85,879,410 I326N probably damaging Het
Vipas39 T C 12: 87,246,160 Y318C probably damaging Het
Vmn1r185 T A 7: 26,611,478 I201F probably damaging Het
Vwce A G 19: 10,664,244 H778R probably benign Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Other mutations in Necab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Necab1 APN 4 15052656 missense probably damaging 1.00
IGL01314:Necab1 APN 4 15005079 missense probably damaging 0.96
IGL01751:Necab1 APN 4 14978171 missense probably damaging 1.00
IGL02098:Necab1 APN 4 14955892 utr 3 prime probably benign
IGL02381:Necab1 APN 4 15148812 splice site probably null
IGL03247:Necab1 APN 4 14960046 missense probably benign
R0095:Necab1 UTSW 4 14960027 missense possibly damaging 0.95
R0095:Necab1 UTSW 4 14960027 missense possibly damaging 0.95
R0321:Necab1 UTSW 4 14960083 missense probably damaging 0.99
R0698:Necab1 UTSW 4 15005041 missense probably benign 0.26
R1125:Necab1 UTSW 4 15111257 missense probably damaging 1.00
R1251:Necab1 UTSW 4 15111192 critical splice donor site probably null
R1400:Necab1 UTSW 4 14975185 missense possibly damaging 0.71
R1771:Necab1 UTSW 4 15111267 missense probably damaging 1.00
R1776:Necab1 UTSW 4 15111267 missense probably damaging 1.00
R2080:Necab1 UTSW 4 15140219 splice site probably benign
R4705:Necab1 UTSW 4 15052628 missense probably damaging 1.00
R4780:Necab1 UTSW 4 14989248 missense probably benign 0.18
R4795:Necab1 UTSW 4 15111208 missense possibly damaging 0.84
R4972:Necab1 UTSW 4 14978216 missense probably damaging 1.00
R5009:Necab1 UTSW 4 14947503 unclassified probably benign
R6102:Necab1 UTSW 4 14989211 missense probably benign 0.05
R6968:Necab1 UTSW 4 14957852 missense probably damaging 1.00
R7458:Necab1 UTSW 4 15111244 missense possibly damaging 0.90
R8130:Necab1 UTSW 4 15005073 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gggatgtaacagtgatggagtg -3'
Posted On 2014-04-13