Mutagenetix > Incidental Mutation

Incidental Mutation 'R1505:Ntrk3'

169113

Institutional Source

Beutler Lab

Gene Symbol

Ntrk3

Ensembl Gene

ENSMUSG00000059146

Gene Name

neurotrophic tyrosine kinase, receptor, type 3

Synonyms

TrkC

MMRRC Submission

040868-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1505 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

78175959-78738012 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 78460524 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 321 (I321F)

Ref Sequence

ENSEMBL: ENSMUSP00000141599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039431] [ENSMUST00000039438] [ENSMUST00000193002] [ENSMUST00000195262]

AlphaFold

Q6VNS1

Predicted Effect

probably damaging
Transcript: ENSMUST00000039431
AA Change: I321F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000037909
Gene: ENSMUSG00000059146
AA Change: I321F

Domain	Start	End	E-Value	Type
LRRNT	31	63	2.46e-4	SMART
LRRCT	160	208	3.58e-12	SMART
IG	216	302	1.24e-8	SMART
Pfam:I-set	308	392	2.4e-8	PFAM
transmembrane domain	430	452	N/A	INTRINSIC
TyrKc	538	810	1.49e-145	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000039438
AA Change: I321F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000038324
Gene: ENSMUSG00000059146
AA Change: I321F

Domain	Start	End	E-Value	Type
LRRNT	31	63	2.46e-4	SMART
LRRCT	160	208	3.58e-12	SMART
IG	216	302	1.24e-8	SMART
Pfam:I-set	308	392	3.1e-8	PFAM
transmembrane domain	429	451	N/A	INTRINSIC
PDB:2MFQ\|B	497	517	2e-6	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155795

Predicted Effect

probably damaging
Transcript: ENSMUST00000193002
AA Change: I321F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000141534
Gene: ENSMUSG00000059146
AA Change: I321F

Domain	Start	End	E-Value	Type
LRRNT	31	63	2.46e-4	SMART
LRRCT	160	208	3.58e-12	SMART
IG	216	302	1.24e-8	SMART
Pfam:I-set	308	392	2.4e-8	PFAM
Pfam:Ig_2	312	392	6.9e-4	PFAM
transmembrane domain	430	452	N/A	INTRINSIC
TyrKc	538	824	4.29e-137	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000195262
AA Change: I321F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000141599
Gene: ENSMUSG00000059146
AA Change: I321F

Domain	Start	End	E-Value	Type
LRRNT	31	63	1.2e-6	SMART
LRRCT	160	208	1.8e-14	SMART
IG	216	302	5.1e-11	SMART
Pfam:I-set	308	392	4.7e-7	PFAM
Pfam:Ig_2	312	392	1.3e-2	PFAM
transmembrane domain	430	452	N/A	INTRINSIC
TyrKc	538	849	9.7e-132	SMART

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.5%
20x: 86.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation and may play a role in the development of proprioceptive neurons that sense body position. Mutations in this gene have been associated with medulloblastomas, secretory breast carcinomas and other cancers. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygotes for targeted mutations show a range of phenotypes including postnatal death at 2-21 days, cardiac defects, reduced numbers of dorsal root ganglia neurons and germ cells, abnormal motor coordination and posture and abnormal sensory innervation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg3	T	A	5: 104,951,565	R444W	probably damaging	Het
Adnp	A	G	2: 168,183,741	S545P	possibly damaging	Het
Ankrd17	T	C	5: 90,300,026	R219G	possibly damaging	Het
Ap2m1	C	G	16: 20,542,697	P372A	probably benign	Het
Calml3	T	A	13: 3,804,071	T45S	probably benign	Het
Casp8	A	G	1: 58,828,922	E174G	probably damaging	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Cfap221	A	C	1: 119,953,628	L368R	probably benign	Het
Chd9	A	G	8: 91,006,495		probably null	Het
Cnot1	A	T	8: 95,728,667	I2035N	probably damaging	Het
Cyp2c67	T	C	19: 39,648,964	R23G	probably benign	Het
Dnah10	A	C	5: 124,754,239	H777P	possibly damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam162b	G	A	10: 51,587,202	A123V	probably damaging	Het
Golgb1	T	A	16: 36,919,643	N2781K	possibly damaging	Het
Hs2st1	C	A	3: 144,434,561	R333L	probably benign	Het
Kmt2e	A	G	5: 23,500,535	H1319R	probably null	Het
Necab1	A	T	4: 14,960,047	M300K	probably benign	Het
Olfr228	A	T	2: 86,483,213	H176Q	possibly damaging	Het
Olfr484	A	G	7: 108,124,993	V90A	probably benign	Het
Olfr860	A	T	9: 19,845,788	M277K	probably benign	Het
Olfr965	A	G	9: 39,719,478	N84D	probably damaging	Het
Osbpl6	T	C	2: 76,579,242	S483P	probably damaging	Het
Pcdhb17	A	C	18: 37,486,822	N555T	probably damaging	Het
Pdgfc	G	A	3: 81,209,236	R299H	possibly damaging	Het
Ptpn7	A	T	1: 135,134,564	T83S	probably benign	Het
Rapgef5	T	C	12: 117,688,619	V79A	possibly damaging	Het
Rexo5	T	A	7: 119,799,603	C54*	probably null	Het
Riok3	A	G	18: 12,152,878	K418R	probably benign	Het
Robo4	G	A	9: 37,403,227	G170D	probably damaging	Het
Rpl8	A	G	15: 76,904,410	D33G	possibly damaging	Het
Rspo2	T	C	15: 43,075,843	T184A	probably damaging	Het
Ryr2	A	T	13: 11,554,592	M4942K	possibly damaging	Het
Sel1l	T	C	12: 91,813,962	Y585C	probably damaging	Het
Slc25a11	G	T	11: 70,646,824	D13E	probably benign	Het
Slc5a6	G	T	5: 31,037,111	H584N	probably benign	Het
Snrpf	A	G	10: 93,583,519	V69A	possibly damaging	Het
Sorbs3	T	A	14: 70,190,802	K475*	probably null	Het
Speg	G	A	1: 75,375,542	V35I	probably benign	Het
Tlk2	T	G	11: 105,260,295	V468G	probably damaging	Het
Trim6	T	A	7: 104,232,564	W341R	probably damaging	Het
Ttll5	T	A	12: 85,879,410	I326N	probably damaging	Het
Vipas39	T	C	12: 87,246,160	Y318C	probably damaging	Het
Vmn1r185	T	A	7: 26,611,478	I201F	probably damaging	Het
Vwce	A	G	19: 10,664,244	H778R	probably benign	Het
Zbtb14	C	G	17: 69,387,764	I152M	probably benign	Het

Other mutations in Ntrk3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00424:Ntrk3	APN	7	78250873	missense	probably benign	0.03
IGL00862:Ntrk3	APN	7	78247177	missense	probably damaging	1.00
IGL00972:Ntrk3	APN	7	78247322	missense	possibly damaging	0.95
IGL00976:Ntrk3	APN	7	78450953	missense	probably benign	0.02
IGL02172:Ntrk3	APN	7	78460272	splice site	probably benign
IGL02175:Ntrk3	APN	7	78247228	missense	probably damaging	1.00
IGL02213:Ntrk3	APN	7	78462931	missense	probably benign	0.17
IGL02363:Ntrk3	APN	7	78453337	missense	probably benign	0.24
IGL02527:Ntrk3	APN	7	78451949	missense	probably benign
IGL02673:Ntrk3	APN	7	78250764	missense	probably damaging	1.00
IGL02755:Ntrk3	APN	7	78460439	missense	probably benign
IGL02998:Ntrk3	APN	7	78577657	missense	probably damaging	0.98
IGL03235:Ntrk3	APN	7	78192592	missense	probably damaging	1.00
R1465:Ntrk3	UTSW	7	78356014	splice site	probably benign
R1638:Ntrk3	UTSW	7	78247288	missense	probably damaging	1.00
R1641:Ntrk3	UTSW	7	78356074	missense	probably damaging	1.00
R1775:Ntrk3	UTSW	7	78356041	missense	possibly damaging	0.60
R1786:Ntrk3	UTSW	7	78477935	splice site	probably benign
R1827:Ntrk3	UTSW	7	78247301	missense	probably damaging	1.00
R1868:Ntrk3	UTSW	7	78192604	missense	possibly damaging	0.90
R1873:Ntrk3	UTSW	7	78462839	missense	probably benign
R1929:Ntrk3	UTSW	7	78516723	splice site	probably null
R1941:Ntrk3	UTSW	7	78247262	missense	probably damaging	1.00
R2132:Ntrk3	UTSW	7	78477935	splice site	probably benign
R2214:Ntrk3	UTSW	7	78516772	missense	probably damaging	1.00
R2221:Ntrk3	UTSW	7	78198852	missense	probably damaging	1.00
R2223:Ntrk3	UTSW	7	78198852	missense	probably damaging	1.00
R2271:Ntrk3	UTSW	7	78516723	splice site	probably null
R2441:Ntrk3	UTSW	7	78302662	missense	probably damaging	1.00
R3108:Ntrk3	UTSW	7	78460515	missense	probably benign	0.01
R3109:Ntrk3	UTSW	7	78460515	missense	probably benign	0.01
R3959:Ntrk3	UTSW	7	78198842	missense	probably damaging	1.00
R4016:Ntrk3	UTSW	7	78462947	splice site	probably benign
R4028:Ntrk3	UTSW	7	78192710	missense	probably damaging	1.00
R4067:Ntrk3	UTSW	7	78517437	missense	probably damaging	1.00
R4398:Ntrk3	UTSW	7	78250769	nonsense	probably null
R4664:Ntrk3	UTSW	7	78461099	missense	probably damaging	0.99
R5045:Ntrk3	UTSW	7	78460424	missense	probably benign	0.13
R5081:Ntrk3	UTSW	7	78577774	missense	probably damaging	0.99
R5151:Ntrk3	UTSW	7	78247300	missense	probably damaging	1.00
R5249:Ntrk3	UTSW	7	78461166	missense	possibly damaging	0.87
R5294:Ntrk3	UTSW	7	78517506	splice site	probably null
R5594:Ntrk3	UTSW	7	78451899	missense	probably benign	0.10
R5923:Ntrk3	UTSW	7	78451928	missense	possibly damaging	0.61
R6878:Ntrk3	UTSW	7	78304372	missense	probably benign	0.00
R7083:Ntrk3	UTSW	7	78250839	missense	probably damaging	1.00
R7178:Ntrk3	UTSW	7	78356147	missense	possibly damaging	0.86
R7487:Ntrk3	UTSW	7	78250713	missense	probably damaging	1.00
R7607:Ntrk3	UTSW	7	78250873	missense	probably benign	0.03
R7800:Ntrk3	UTSW	7	78302740	missense	probably benign	0.09
R7961:Ntrk3	UTSW	7	78453328	missense	probably benign
R7976:Ntrk3	UTSW	7	78356206	missense	probably damaging	0.97
R8009:Ntrk3	UTSW	7	78453328	missense	probably benign
R8032:Ntrk3	UTSW	7	78356059	missense	probably damaging	1.00
R8104:Ntrk3	UTSW	7	78577702	missense	probably damaging	0.99
R8230:Ntrk3	UTSW	7	78250770	missense	probably damaging	1.00
R8254:Ntrk3	UTSW	7	78192578	missense	probably damaging	1.00
R8412:Ntrk3	UTSW	7	78356149	missense	probably benign	0.02
R8465:Ntrk3	UTSW	7	78462883	missense	probably damaging	0.99
R8841:Ntrk3	UTSW	7	78356093	missense	probably damaging	0.99
R9187:Ntrk3	UTSW	7	78247218	missense	possibly damaging	0.93
R9444:Ntrk3	UTSW	7	78461057	missense	probably damaging	1.00
R9475:Ntrk3	UTSW	7	78302732	missense	probably benign	0.27

Predicted Primers

PCR Primer
(F):5'- CACAAGATGCAGATAGTGGCTCTCC -3'
(R):5'- CTTTCCAGAGCAGGGTGAGAAGTG -3'

Sequencing Primer
(F):5'- AGCTCCGTTATTCAGGTAACTAGG -3'
(R):5'- GATCAGCTTGCTTTTCCCCA -3'

Posted On

2014-04-13