Mutagenetix > Incidental Mutations

Incidental Mutation 'R1505:Robo4'

169120

Institutional Source

Beutler Lab

Gene Symbol

Robo4

Ensembl Gene

ENSMUSG00000032125

Gene Name

roundabout guidance receptor 4

Synonyms

1200012D01Rik, Magic roundabout

MMRRC Submission

040868-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.217) question?

Stock #

R1505 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

37401897-37415115 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 37403227 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 170 (G170D)

Ref Sequence

ENSEMBL: ENSMUSP00000110698 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102895] [ENSMUST00000115046] [ENSMUST00000115048] [ENSMUST00000156972] [ENSMUST00000214185]

Predicted Effect

probably damaging
Transcript: ENSMUST00000102895
AA Change: G170D

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000099959
Gene: ENSMUSG00000032125
AA Change: G170D

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
IG	48	144	2.51e0	SMART
IGc2	160	225	6.86e-11	SMART
FN3	263	343	2.05e0	SMART
FN3	358	440	1.27e-3	SMART
low complexity region	488	494	N/A	INTRINSIC
low complexity region	544	562	N/A	INTRINSIC
low complexity region	720	733	N/A	INTRINSIC
low complexity region	748	762	N/A	INTRINSIC
low complexity region	775	799	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	871	880	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115046
AA Change: G170D

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000110698
Gene: ENSMUSG00000032125
AA Change: G170D

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
IG	48	144	2.51e0	SMART
IGc2	160	225	6.86e-11	SMART
FN3	263	343	2.05e0	SMART
FN3	358	440	1.27e-3	SMART
low complexity region	484	500	N/A	INTRINSIC
low complexity region	540	546	N/A	INTRINSIC
low complexity region	596	614	N/A	INTRINSIC
low complexity region	747	756	N/A	INTRINSIC
low complexity region	779	792	N/A	INTRINSIC
low complexity region	807	821	N/A	INTRINSIC
low complexity region	834	858	N/A	INTRINSIC
low complexity region	914	925	N/A	INTRINSIC
low complexity region	930	939	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115048
AA Change: G59D

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000110700
Gene: ENSMUSG00000032125
AA Change: G59D

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
IG	48	144	2.51e0	SMART
IGc2	160	225	6.86e-11	SMART
FN3	263	343	2.05e0	SMART
FN3	358	440	1.27e-3	SMART
low complexity region	488	494	N/A	INTRINSIC
low complexity region	544	562	N/A	INTRINSIC
low complexity region	695	704	N/A	INTRINSIC
low complexity region	727	740	N/A	INTRINSIC
low complexity region	755	769	N/A	INTRINSIC
low complexity region	782	806	N/A	INTRINSIC
low complexity region	862	873	N/A	INTRINSIC
low complexity region	878	887	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000156972
AA Change: G170D

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

probably damaging
Transcript: ENSMUST00000214185
AA Change: G170D

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.5%
20x: 86.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a reporter/null allele display enhanced VEGF-induced endothelial migration, tube formation and vascular permeability, and show increased pathologic angiogenesis and vascular leak in models of oxygen-induced retinopathy and choroidal neovascularization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg3	T	A	5: 104,951,565	R444W	probably damaging	Het
Adnp	A	G	2: 168,183,741	S545P	possibly damaging	Het
Ankrd17	T	C	5: 90,300,026	R219G	possibly damaging	Het
Ap2m1	C	G	16: 20,542,697	P372A	probably benign	Het
Calml3	T	A	13: 3,804,071	T45S	probably benign	Het
Casp8	A	G	1: 58,828,922	E174G	probably damaging	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Cfap221	A	C	1: 119,953,628	L368R	probably benign	Het
Chd9	A	G	8: 91,006,495		probably null	Het
Cnot1	A	T	8: 95,728,667	I2035N	probably damaging	Het
Cyp2c67	T	C	19: 39,648,964	R23G	probably benign	Het
Dnah10	A	C	5: 124,754,239	H777P	possibly damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam162b	G	A	10: 51,587,202	A123V	probably damaging	Het
Golgb1	T	A	16: 36,919,643	N2781K	possibly damaging	Het
Hs2st1	C	A	3: 144,434,561	R333L	probably benign	Het
Kmt2e	A	G	5: 23,500,535	H1319R	probably null	Het
Necab1	A	T	4: 14,960,047	M300K	probably benign	Het
Ntrk3	T	A	7: 78,460,524	I321F	probably damaging	Het
Olfr228	A	T	2: 86,483,213	H176Q	possibly damaging	Het
Olfr484	A	G	7: 108,124,993	V90A	probably benign	Het
Olfr860	A	T	9: 19,845,788	M277K	probably benign	Het
Olfr965	A	G	9: 39,719,478	N84D	probably damaging	Het
Osbpl6	T	C	2: 76,579,242	S483P	probably damaging	Het
Pcdhb17	A	C	18: 37,486,822	N555T	probably damaging	Het
Pdgfc	G	A	3: 81,209,236	R299H	possibly damaging	Het
Ptpn7	A	T	1: 135,134,564	T83S	probably benign	Het
Rapgef5	T	C	12: 117,688,619	V79A	possibly damaging	Het
Rexo5	T	A	7: 119,799,603	C54*	probably null	Het
Riok3	A	G	18: 12,152,878	K418R	probably benign	Het
Rpl8	A	G	15: 76,904,410	D33G	possibly damaging	Het
Rspo2	T	C	15: 43,075,843	T184A	probably damaging	Het
Ryr2	A	T	13: 11,554,592	M4942K	possibly damaging	Het
Sel1l	T	C	12: 91,813,962	Y585C	probably damaging	Het
Slc25a11	G	T	11: 70,646,824	D13E	probably benign	Het
Slc5a6	G	T	5: 31,037,111	H584N	probably benign	Het
Snrpf	A	G	10: 93,583,519	V69A	possibly damaging	Het
Sorbs3	T	A	14: 70,190,802	K475*	probably null	Het
Speg	G	A	1: 75,375,542	V35I	probably benign	Het
Tlk2	T	G	11: 105,260,295	V468G	probably damaging	Het
Trim6	T	A	7: 104,232,564	W341R	probably damaging	Het
Ttll5	T	A	12: 85,879,410	I326N	probably damaging	Het
Vipas39	T	C	12: 87,246,160	Y318C	probably damaging	Het
Vmn1r185	T	A	7: 26,611,478	I201F	probably damaging	Het
Vwce	A	G	19: 10,664,244	H778R	probably benign	Het
Zbtb14	C	G	17: 69,387,764	I152M	probably benign	Het

Other mutations in Robo4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Robo4	APN	9	37411104	missense	probably damaging	1.00
IGL00392:Robo4	APN	9	37408229	missense	probably damaging	1.00
IGL00491:Robo4	APN	9	37405935	missense	possibly damaging	0.52
IGL00792:Robo4	APN	9	37408211	missense	probably damaging	1.00
IGL01062:Robo4	APN	9	37406000	missense	probably benign	0.08
IGL01287:Robo4	APN	9	37413040	missense	possibly damaging	0.96
IGL02289:Robo4	APN	9	37408200	missense	probably damaging	1.00
IGL02486:Robo4	APN	9	37408374	missense	probably damaging	1.00
IGL02851:Robo4	APN	9	37413382	missense	probably damaging	0.96
IGL02898:Robo4	APN	9	37408176	missense	probably damaging	0.99
IGL02965:Robo4	APN	9	37410469	missense	possibly damaging	0.82
IGL03071:Robo4	APN	9	37404284	splice site	probably benign
IGL03102:Robo4	APN	9	37404185	missense	probably damaging	1.00
H8562:Robo4	UTSW	9	37405810	intron	probably benign
PIT4305001:Robo4	UTSW	9	37411391	missense	probably damaging	1.00
R0056:Robo4	UTSW	9	37404477	missense	probably benign	0.03
R0068:Robo4	UTSW	9	37404477	missense	probably benign	0.03
R0233:Robo4	UTSW	9	37402681	missense	probably damaging	1.00
R0233:Robo4	UTSW	9	37402681	missense	probably damaging	1.00
R0416:Robo4	UTSW	9	37404766	splice site	probably benign
R1005:Robo4	UTSW	9	37408251	missense	probably damaging	1.00
R1174:Robo4	UTSW	9	37413052	missense	probably damaging	1.00
R1183:Robo4	UTSW	9	37408052	missense	probably damaging	1.00
R1254:Robo4	UTSW	9	37410840	critical splice donor site	probably null
R1398:Robo4	UTSW	9	37408076	critical splice donor site	probably null
R1701:Robo4	UTSW	9	37403443	missense	probably benign	0.44
R1834:Robo4	UTSW	9	37413059	missense	probably benign	0.09
R1899:Robo4	UTSW	9	37404070	splice site	probably benign
R2203:Robo4	UTSW	9	37411490	frame shift	probably null
R2204:Robo4	UTSW	9	37411490	frame shift	probably null
R2351:Robo4	UTSW	9	37411660	missense	probably benign	0.01
R2448:Robo4	UTSW	9	37402662	missense	possibly damaging	0.96
R2847:Robo4	UTSW	9	37404476	nonsense	probably null
R2851:Robo4	UTSW	9	37411490	frame shift	probably null
R2852:Robo4	UTSW	9	37411490	frame shift	probably null
R2877:Robo4	UTSW	9	37411490	frame shift	probably null
R3123:Robo4	UTSW	9	37411490	frame shift	probably null
R3124:Robo4	UTSW	9	37411490	frame shift	probably null
R3125:Robo4	UTSW	9	37411490	frame shift	probably null
R3805:Robo4	UTSW	9	37404438	missense	possibly damaging	0.73
R3806:Robo4	UTSW	9	37404438	missense	possibly damaging	0.73
R3892:Robo4	UTSW	9	37411490	frame shift	probably null
R3905:Robo4	UTSW	9	37403505	nonsense	probably null
R3938:Robo4	UTSW	9	37402017	start gained	probably benign
R4261:Robo4	UTSW	9	37405581	missense	probably benign	0.04
R4434:Robo4	UTSW	9	37411490	frame shift	probably null
R4435:Robo4	UTSW	9	37411490	frame shift	probably null
R4561:Robo4	UTSW	9	37411490	frame shift	probably null
R4562:Robo4	UTSW	9	37411490	frame shift	probably null
R4568:Robo4	UTSW	9	37404822	missense	possibly damaging	0.59
R4695:Robo4	UTSW	9	37403199	missense	probably damaging	1.00
R4921:Robo4	UTSW	9	37402560	missense	probably benign
R5000:Robo4	UTSW	9	37408368	missense	probably benign	0.02
R5056:Robo4	UTSW	9	37404806	missense	probably benign	0.00
R5125:Robo4	UTSW	9	37407960	missense	probably damaging	1.00
R5178:Robo4	UTSW	9	37407960	missense	probably damaging	1.00
R5278:Robo4	UTSW	9	37411490	frame shift	probably null
R5279:Robo4	UTSW	9	37411490	frame shift	probably null
R5285:Robo4	UTSW	9	37411490	frame shift	probably null
R5347:Robo4	UTSW	9	37411490	frame shift	probably null
R5348:Robo4	UTSW	9	37411490	frame shift	probably null
R5361:Robo4	UTSW	9	37413378	missense	probably benign	0.01
R5403:Robo4	UTSW	9	37411490	frame shift	probably null
R5404:Robo4	UTSW	9	37411490	frame shift	probably null
R5488:Robo4	UTSW	9	37411490	frame shift	probably null
R5489:Robo4	UTSW	9	37411490	frame shift	probably null
R5490:Robo4	UTSW	9	37411490	frame shift	probably null
R5494:Robo4	UTSW	9	37411490	frame shift	probably null
R5629:Robo4	UTSW	9	37408362	missense	probably damaging	1.00
R5736:Robo4	UTSW	9	37404797	missense	possibly damaging	0.63
R5796:Robo4	UTSW	9	37411674	missense	probably benign	0.00
R5987:Robo4	UTSW	9	37411400	missense	probably damaging	1.00
R6178:Robo4	UTSW	9	37405630	nonsense	probably null
R6189:Robo4	UTSW	9	37403533	missense	probably benign	0.35
R6365:Robo4	UTSW	9	37410712	missense	probably benign	0.34
R6528:Robo4	UTSW	9	37404368	missense	possibly damaging	0.92
R6887:Robo4	UTSW	9	37402067	missense	possibly damaging	0.82
R7196:Robo4	UTSW	9	37402705	missense	possibly damaging	0.92
R7408:Robo4	UTSW	9	37410981	missense	probably benign	0.09
R7419:Robo4	UTSW	9	37402809	missense	probably benign	0.18
R7486:Robo4	UTSW	9	37405574	missense	probably damaging	0.99
R7707:Robo4	UTSW	9	37413122	missense	probably damaging	1.00
R7839:Robo4	UTSW	9	37410759	missense	probably damaging	1.00
R7922:Robo4	UTSW	9	37410759	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACATTACCTTTTGCCGGATGGGAC -3'
(R):5'- TTGCTCAATGTGCCCAGGACAG -3'

Sequencing Primer
(F):5'- ATGCTTGTGTCCAGGGAAATAC -3'
(R):5'- CCCAGGACAGGATGATGTATG -3'

Posted On

2014-04-13