Incidental Mutation 'R1505:Olfr965'
ID 169121
Institutional Source Beutler Lab
Gene Symbol Olfr965
Ensembl Gene ENSMUSG00000095839
Gene Name olfactory receptor 965
Synonyms GA_x6K02T2PVTD-33416730-33417668, MOR171-28
MMRRC Submission 040868-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock # R1505 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 39711353-39720614 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 39719478 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 84 (N84D)
Ref Sequence ENSEMBL: ENSMUSP00000150401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069342] [ENSMUST00000213335] [ENSMUST00000215164]
AlphaFold Q7TRA7
Predicted Effect probably damaging
Transcript: ENSMUST00000069342
AA Change: N84D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000069696
Gene: ENSMUSG00000095839
AA Change: N84D

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.4e-47 PFAM
Pfam:7tm_1 41 290 4.2e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213335
AA Change: N84D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214875
Predicted Effect probably damaging
Transcript: ENSMUST00000215164
AA Change: N84D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 86.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T A 5: 104,951,565 R444W probably damaging Het
Adnp A G 2: 168,183,741 S545P possibly damaging Het
Ankrd17 T C 5: 90,300,026 R219G possibly damaging Het
Ap2m1 C G 16: 20,542,697 P372A probably benign Het
Calml3 T A 13: 3,804,071 T45S probably benign Het
Casp8 A G 1: 58,828,922 E174G probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap221 A C 1: 119,953,628 L368R probably benign Het
Chd9 A G 8: 91,006,495 probably null Het
Cnot1 A T 8: 95,728,667 I2035N probably damaging Het
Cyp2c67 T C 19: 39,648,964 R23G probably benign Het
Dnah10 A C 5: 124,754,239 H777P possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam162b G A 10: 51,587,202 A123V probably damaging Het
Golgb1 T A 16: 36,919,643 N2781K possibly damaging Het
Hs2st1 C A 3: 144,434,561 R333L probably benign Het
Kmt2e A G 5: 23,500,535 H1319R probably null Het
Necab1 A T 4: 14,960,047 M300K probably benign Het
Ntrk3 T A 7: 78,460,524 I321F probably damaging Het
Olfr228 A T 2: 86,483,213 H176Q possibly damaging Het
Olfr484 A G 7: 108,124,993 V90A probably benign Het
Olfr860 A T 9: 19,845,788 M277K probably benign Het
Osbpl6 T C 2: 76,579,242 S483P probably damaging Het
Pcdhb17 A C 18: 37,486,822 N555T probably damaging Het
Pdgfc G A 3: 81,209,236 R299H possibly damaging Het
Ptpn7 A T 1: 135,134,564 T83S probably benign Het
Rapgef5 T C 12: 117,688,619 V79A possibly damaging Het
Rexo5 T A 7: 119,799,603 C54* probably null Het
Riok3 A G 18: 12,152,878 K418R probably benign Het
Robo4 G A 9: 37,403,227 G170D probably damaging Het
Rpl8 A G 15: 76,904,410 D33G possibly damaging Het
Rspo2 T C 15: 43,075,843 T184A probably damaging Het
Ryr2 A T 13: 11,554,592 M4942K possibly damaging Het
Sel1l T C 12: 91,813,962 Y585C probably damaging Het
Slc25a11 G T 11: 70,646,824 D13E probably benign Het
Slc5a6 G T 5: 31,037,111 H584N probably benign Het
Snrpf A G 10: 93,583,519 V69A possibly damaging Het
Sorbs3 T A 14: 70,190,802 K475* probably null Het
Speg G A 1: 75,375,542 V35I probably benign Het
Tlk2 T G 11: 105,260,295 V468G probably damaging Het
Trim6 T A 7: 104,232,564 W341R probably damaging Het
Ttll5 T A 12: 85,879,410 I326N probably damaging Het
Vipas39 T C 12: 87,246,160 Y318C probably damaging Het
Vmn1r185 T A 7: 26,611,478 I201F probably damaging Het
Vwce A G 19: 10,664,244 H778R probably benign Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Other mutations in Olfr965
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Olfr965 APN 9 39719581 missense possibly damaging 0.95
IGL02365:Olfr965 APN 9 39719674 missense possibly damaging 0.60
IGL02365:Olfr965 APN 9 39720100 missense probably damaging 0.98
IGL03062:Olfr965 APN 9 39720035 missense probably benign 0.26
IGL03330:Olfr965 APN 9 39719488 missense probably benign 0.08
R0011:Olfr965 UTSW 9 39719627 missense probably benign 0.26
R0462:Olfr965 UTSW 9 39719410 missense probably benign 0.01
R1995:Olfr965 UTSW 9 39719413 missense probably damaging 1.00
R2049:Olfr965 UTSW 9 39720115 missense probably damaging 1.00
R2110:Olfr965 UTSW 9 39719722 missense probably benign 0.30
R3817:Olfr965 UTSW 9 39720108 missense possibly damaging 0.95
R4152:Olfr965 UTSW 9 39720000 missense probably benign 0.10
R4153:Olfr965 UTSW 9 39720000 missense probably benign 0.10
R4351:Olfr965 UTSW 9 39719569 missense probably damaging 0.99
R4377:Olfr965 UTSW 9 39719807 missense probably benign 0.04
R4667:Olfr965 UTSW 9 39719709 missense probably benign 0.09
R5526:Olfr965 UTSW 9 39719596 missense possibly damaging 0.95
R5816:Olfr965 UTSW 9 39719230 start codon destroyed probably null 1.00
R7113:Olfr965 UTSW 9 39719677 missense probably benign
R7336:Olfr965 UTSW 9 39719610 missense probably benign 0.28
R8153:Olfr965 UTSW 9 39719658 missense possibly damaging 0.68
R8291:Olfr965 UTSW 9 39719545 missense probably benign 0.00
R8779:Olfr965 UTSW 9 39719340 missense probably damaging 0.99
R9617:Olfr965 UTSW 9 39719382 missense possibly damaging 0.80
R9631:Olfr965 UTSW 9 39719865 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- ATCTACTTGTTCACGGAGCTGGGG -3'
(R):5'- CTCAAGATTGTCAGCATTGGCACAC -3'

Sequencing Primer
(F):5'- GGAACCTGGGCATGGTC -3'
(R):5'- CCTCATTGACAAATGTGCTGGAG -3'
Posted On 2014-04-13