Incidental Mutation 'R1505:Tlk2'
ID169128
Institutional Source Beutler Lab
Gene Symbol Tlk2
Ensembl Gene ENSMUSG00000020694
Gene Nametousled-like kinase 2 (Arabidopsis)
Synonymsprotein kinase U-alpha, 4933403M19Rik, PKUalpha
MMRRC Submission 040868-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.737) question?
Stock #R1505 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location105178807-105283959 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 105260295 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 468 (V468G)
Ref Sequence ENSEMBL: ENSMUSP00000102554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015107] [ENSMUST00000092537] [ENSMUST00000106939] [ENSMUST00000106941] [ENSMUST00000126175] [ENSMUST00000145048]
Predicted Effect probably damaging
Transcript: ENSMUST00000015107
AA Change: V436G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000015107
Gene: ENSMUSG00000020694
AA Change: V436G

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
low complexity region 102 113 N/A INTRINSIC
coiled coil region 202 237 N/A INTRINSIC
coiled coil region 285 314 N/A INTRINSIC
coiled coil region 355 393 N/A INTRINSIC
S_TKc 408 687 1.63e-78 SMART
low complexity region 696 717 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092537
AA Change: V468G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090198
Gene: ENSMUSG00000020694
AA Change: V468G

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
low complexity region 92 106 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
coiled coil region 234 269 N/A INTRINSIC
coiled coil region 317 346 N/A INTRINSIC
coiled coil region 387 425 N/A INTRINSIC
Pfam:Pkinase 440 675 9.4e-52 PFAM
Pfam:Pkinase_Tyr 441 669 3.5e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106939
AA Change: V436G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102552
Gene: ENSMUSG00000020694
AA Change: V436G

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
low complexity region 102 113 N/A INTRINSIC
coiled coil region 202 237 N/A INTRINSIC
coiled coil region 285 314 N/A INTRINSIC
coiled coil region 355 393 N/A INTRINSIC
S_TKc 408 687 1.63e-78 SMART
low complexity region 696 717 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106941
AA Change: V468G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102554
Gene: ENSMUSG00000020694
AA Change: V468G

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
low complexity region 92 106 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
coiled coil region 234 269 N/A INTRINSIC
coiled coil region 317 346 N/A INTRINSIC
coiled coil region 387 425 N/A INTRINSIC
S_TKc 440 719 1.63e-78 SMART
low complexity region 728 749 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126175
SMART Domains Protein: ENSMUSP00000120944
Gene: ENSMUSG00000020694

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000145048
AA Change: V404G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118520
Gene: ENSMUSG00000020694
AA Change: V404G

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
low complexity region 102 113 N/A INTRINSIC
coiled coil region 170 205 N/A INTRINSIC
coiled coil region 253 282 N/A INTRINSIC
coiled coil region 323 361 N/A INTRINSIC
Pfam:Pkinase 376 611 2.4e-51 PFAM
Pfam:Pkinase_Tyr 377 605 8.5e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146910
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 86.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear serine/threonine kinase that was first identified in Arabidopsis. The encoded protein is thought to function in the regulation of chromatin assembly in the S phase of the cell cycle by regulating the levels of a histone H3/H4 chaperone. This protein is associated with double-strand break repair of DNA damage caused by radiation. Pseudogenes of this gene are present on chromosomes 10 and 17. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T A 5: 104,951,565 R444W probably damaging Het
Adnp A G 2: 168,183,741 S545P possibly damaging Het
Ankrd17 T C 5: 90,300,026 R219G possibly damaging Het
Ap2m1 C G 16: 20,542,697 P372A probably benign Het
Calml3 T A 13: 3,804,071 T45S probably benign Het
Casp8 A G 1: 58,828,922 E174G probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap221 A C 1: 119,953,628 L368R probably benign Het
Chd9 A G 8: 91,006,495 probably null Het
Cnot1 A T 8: 95,728,667 I2035N probably damaging Het
Cyp2c67 T C 19: 39,648,964 R23G probably benign Het
Dnah10 A C 5: 124,754,239 H777P possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam162b G A 10: 51,587,202 A123V probably damaging Het
Golgb1 T A 16: 36,919,643 N2781K possibly damaging Het
Hs2st1 C A 3: 144,434,561 R333L probably benign Het
Kmt2e A G 5: 23,500,535 H1319R probably null Het
Necab1 A T 4: 14,960,047 M300K probably benign Het
Ntrk3 T A 7: 78,460,524 I321F probably damaging Het
Olfr228 A T 2: 86,483,213 H176Q possibly damaging Het
Olfr484 A G 7: 108,124,993 V90A probably benign Het
Olfr860 A T 9: 19,845,788 M277K probably benign Het
Olfr965 A G 9: 39,719,478 N84D probably damaging Het
Osbpl6 T C 2: 76,579,242 S483P probably damaging Het
Pcdhb17 A C 18: 37,486,822 N555T probably damaging Het
Pdgfc G A 3: 81,209,236 R299H possibly damaging Het
Ptpn7 A T 1: 135,134,564 T83S probably benign Het
Rapgef5 T C 12: 117,688,619 V79A possibly damaging Het
Rexo5 T A 7: 119,799,603 C54* probably null Het
Riok3 A G 18: 12,152,878 K418R probably benign Het
Robo4 G A 9: 37,403,227 G170D probably damaging Het
Rpl8 A G 15: 76,904,410 D33G possibly damaging Het
Rspo2 T C 15: 43,075,843 T184A probably damaging Het
Ryr2 A T 13: 11,554,592 M4942K possibly damaging Het
Sel1l T C 12: 91,813,962 Y585C probably damaging Het
Slc25a11 G T 11: 70,646,824 D13E probably benign Het
Slc5a6 G T 5: 31,037,111 H584N probably benign Het
Snrpf A G 10: 93,583,519 V69A possibly damaging Het
Sorbs3 T A 14: 70,190,802 K475* probably null Het
Speg G A 1: 75,375,542 V35I probably benign Het
Trim6 T A 7: 104,232,564 W341R probably damaging Het
Ttll5 T A 12: 85,879,410 I326N probably damaging Het
Vipas39 T C 12: 87,246,160 Y318C probably damaging Het
Vmn1r185 T A 7: 26,611,478 I201F probably damaging Het
Vwce A G 19: 10,664,244 H778R probably benign Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Other mutations in Tlk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Tlk2 APN 11 105246795 nonsense probably null
IGL00956:Tlk2 APN 11 105247592 missense probably benign 0.01
IGL01083:Tlk2 APN 11 105221224 missense probably benign 0.11
IGL02523:Tlk2 APN 11 105275947 missense probably damaging 0.99
IGL02694:Tlk2 APN 11 105221235 missense probably benign 0.19
H8786:Tlk2 UTSW 11 105254979 missense possibly damaging 0.93
PIT4378001:Tlk2 UTSW 11 105281220 missense unknown
R0310:Tlk2 UTSW 11 105254973 missense probably benign 0.15
R1457:Tlk2 UTSW 11 105256952 critical splice donor site probably null
R1856:Tlk2 UTSW 11 105221298 missense probably benign 0.00
R2069:Tlk2 UTSW 11 105240440 missense probably benign 0.22
R2305:Tlk2 UTSW 11 105241591 missense possibly damaging 0.47
R2351:Tlk2 UTSW 11 105209830 missense probably damaging 1.00
R3724:Tlk2 UTSW 11 105247564 missense probably benign 0.01
R4607:Tlk2 UTSW 11 105255018 missense probably damaging 1.00
R4641:Tlk2 UTSW 11 105275983 missense probably benign 0.41
R4738:Tlk2 UTSW 11 105256882 missense probably benign 0.22
R4803:Tlk2 UTSW 11 105281100 missense probably damaging 1.00
R4957:Tlk2 UTSW 11 105253359 critical splice donor site probably null
R5407:Tlk2 UTSW 11 105240375 missense probably damaging 0.98
R5551:Tlk2 UTSW 11 105221307 missense probably benign 0.05
R6456:Tlk2 UTSW 11 105221273 missense probably benign 0.05
R6922:Tlk2 UTSW 11 105256953 critical splice donor site probably null
R7183:Tlk2 UTSW 11 105221359 splice site probably null
R7265:Tlk2 UTSW 11 105184244 nonsense probably null
R7760:Tlk2 UTSW 11 105279167 missense probably damaging 1.00
R7797:Tlk2 UTSW 11 105210618 missense probably benign 0.00
R7823:Tlk2 UTSW 11 105253307 missense probably damaging 1.00
Z1177:Tlk2 UTSW 11 105184290 missense not run
Predicted Primers PCR Primer
(F):5'- TTGGGAGCAAGCCTGAGAACATC -3'
(R):5'- TCTGAGCTGGAGTGAGCAGAGAC -3'

Sequencing Primer
(F):5'- AGCCTGAGAACATCTGCTTG -3'
(R):5'- caattcccagcaaccacac -3'
Posted On2014-04-13