Mutagenetix > Incidental Mutation

Incidental Mutation 'R1505:Sel1l'

169131

Institutional Source

Beutler Lab

Gene Symbol

Sel1l

Ensembl Gene

ENSMUSG00000020964

Gene Name

sel-1 suppressor of lin-12-like (C. elegans)

Synonyms

Sel1h

MMRRC Submission

040868-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1505 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

91806043-91849157 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 91813962 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 585 (Y585C)

Ref Sequence

ENSEMBL: ENSMUSP00000129384 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021347] [ENSMUST00000167466] [ENSMUST00000178462]

AlphaFold

Q9Z2G6

Predicted Effect

probably damaging
Transcript: ENSMUST00000021347
AA Change: Y635C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000021347
Gene: ENSMUSG00000020964
AA Change: Y635C

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
FN2	116	164	1.24e-24	SMART
SEL1	179	214	2.48e-1	SMART
SEL1	215	250	7.5e1	SMART
SEL1	251	286	1.86e-5	SMART
SEL1	287	322	1.16e-1	SMART
SEL1	369	405	7.93e-9	SMART
SEL1	406	442	8.05e-10	SMART
SEL1	443	478	2.48e-10	SMART
SEL1	479	514	1.91e-11	SMART
SEL1	515	550	9.04e-4	SMART
Pfam:Sel1	585	622	3.4e-1	PFAM
SEL1	623	658	4.42e-7	SMART
SEL1	660	695	2.28e-9	SMART
low complexity region	766	790	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165282

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166691

Predicted Effect

probably damaging
Transcript: ENSMUST00000167466
AA Change: Y585C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129384
Gene: ENSMUSG00000020964
AA Change: Y585C

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
SEL1	129	164	2.48e-1	SMART
SEL1	165	200	7.5e1	SMART
SEL1	201	236	1.86e-5	SMART
SEL1	237	272	1.16e-1	SMART
SEL1	319	355	7.93e-9	SMART
SEL1	356	392	8.05e-10	SMART
SEL1	393	428	2.48e-10	SMART
SEL1	429	464	1.91e-11	SMART
SEL1	465	500	9.04e-4	SMART
Pfam:Sel1	534	572	1.5e-1	PFAM
SEL1	573	608	4.42e-7	SMART
SEL1	610	645	2.28e-9	SMART
low complexity region	716	740	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171465

Predicted Effect

probably damaging
Transcript: ENSMUST00000178462
AA Change: Y585C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000136087
Gene: ENSMUSG00000020964
AA Change: Y585C

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
SEL1	129	164	2.48e-1	SMART
SEL1	165	200	7.5e1	SMART
SEL1	201	236	1.86e-5	SMART
SEL1	237	272	1.16e-1	SMART
SEL1	319	355	7.93e-9	SMART
SEL1	356	392	8.05e-10	SMART
SEL1	393	428	2.48e-10	SMART
SEL1	429	464	1.91e-11	SMART
SEL1	465	500	9.04e-4	SMART
Pfam:Sel1	535	572	3.2e-1	PFAM
SEL1	573	608	4.42e-7	SMART
SEL1	610	645	2.28e-9	SMART
low complexity region	716	740	N/A	INTRINSIC

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.5%
20x: 86.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a protein complex required for the retrotranslocation or dislocation of misfolded proteins from the endoplasmic reticulum lumen to the cytosol, where they are degraded by the proteasome in a ubiquitin-dependent manner. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit prenatal lethality with impaired exocrine and endocrine pancreatic development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg3	T	A	5: 104,951,565	R444W	probably damaging	Het
Adnp	A	G	2: 168,183,741	S545P	possibly damaging	Het
Ankrd17	T	C	5: 90,300,026	R219G	possibly damaging	Het
Ap2m1	C	G	16: 20,542,697	P372A	probably benign	Het
Calml3	T	A	13: 3,804,071	T45S	probably benign	Het
Casp8	A	G	1: 58,828,922	E174G	probably damaging	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Cfap221	A	C	1: 119,953,628	L368R	probably benign	Het
Chd9	A	G	8: 91,006,495		probably null	Het
Cnot1	A	T	8: 95,728,667	I2035N	probably damaging	Het
Cyp2c67	T	C	19: 39,648,964	R23G	probably benign	Het
Dnah10	A	C	5: 124,754,239	H777P	possibly damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam162b	G	A	10: 51,587,202	A123V	probably damaging	Het
Golgb1	T	A	16: 36,919,643	N2781K	possibly damaging	Het
Hs2st1	C	A	3: 144,434,561	R333L	probably benign	Het
Kmt2e	A	G	5: 23,500,535	H1319R	probably null	Het
Necab1	A	T	4: 14,960,047	M300K	probably benign	Het
Ntrk3	T	A	7: 78,460,524	I321F	probably damaging	Het
Olfr228	A	T	2: 86,483,213	H176Q	possibly damaging	Het
Olfr484	A	G	7: 108,124,993	V90A	probably benign	Het
Olfr860	A	T	9: 19,845,788	M277K	probably benign	Het
Olfr965	A	G	9: 39,719,478	N84D	probably damaging	Het
Osbpl6	T	C	2: 76,579,242	S483P	probably damaging	Het
Pcdhb17	A	C	18: 37,486,822	N555T	probably damaging	Het
Pdgfc	G	A	3: 81,209,236	R299H	possibly damaging	Het
Ptpn7	A	T	1: 135,134,564	T83S	probably benign	Het
Rapgef5	T	C	12: 117,688,619	V79A	possibly damaging	Het
Rexo5	T	A	7: 119,799,603	C54*	probably null	Het
Riok3	A	G	18: 12,152,878	K418R	probably benign	Het
Robo4	G	A	9: 37,403,227	G170D	probably damaging	Het
Rpl8	A	G	15: 76,904,410	D33G	possibly damaging	Het
Rspo2	T	C	15: 43,075,843	T184A	probably damaging	Het
Ryr2	A	T	13: 11,554,592	M4942K	possibly damaging	Het
Slc25a11	G	T	11: 70,646,824	D13E	probably benign	Het
Slc5a6	G	T	5: 31,037,111	H584N	probably benign	Het
Snrpf	A	G	10: 93,583,519	V69A	possibly damaging	Het
Sorbs3	T	A	14: 70,190,802	K475*	probably null	Het
Speg	G	A	1: 75,375,542	V35I	probably benign	Het
Tlk2	T	G	11: 105,260,295	V468G	probably damaging	Het
Trim6	T	A	7: 104,232,564	W341R	probably damaging	Het
Ttll5	T	A	12: 85,879,410	I326N	probably damaging	Het
Vipas39	T	C	12: 87,246,160	Y318C	probably damaging	Het
Vmn1r185	T	A	7: 26,611,478	I201F	probably damaging	Het
Vwce	A	G	19: 10,664,244	H778R	probably benign	Het
Zbtb14	C	G	17: 69,387,764	I152M	probably benign	Het

Other mutations in Sel1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:Sel1l	APN	12	91814613	splice site	probably benign
IGL01082:Sel1l	APN	12	91811908	missense	probably benign	0.41
IGL01402:Sel1l	APN	12	91841833	missense	possibly damaging	0.55
IGL01610:Sel1l	APN	12	91817290	missense	probably damaging	1.00
IGL01690:Sel1l	APN	12	91843259	missense	probably benign
IGL01803:Sel1l	APN	12	91830730	missense	probably benign	0.37
IGL01939:Sel1l	APN	12	91816247	missense	probably damaging	1.00
IGL02275:Sel1l	APN	12	91815015	missense	probably damaging	1.00
IGL02279:Sel1l	APN	12	91814997	missense	probably damaging	1.00
IGL02407:Sel1l	APN	12	91843268	splice site	probably benign
IGL02934:Sel1l	APN	12	91809936	nonsense	probably null
R0533:Sel1l	UTSW	12	91820094	missense	probably damaging	1.00
R0565:Sel1l	UTSW	12	91811889	missense	probably benign	0.16
R0565:Sel1l	UTSW	12	91813945	missense	possibly damaging	0.95
R0973:Sel1l	UTSW	12	91824860	missense	probably damaging	1.00
R1378:Sel1l	UTSW	12	91833097	splice site	probably null
R1530:Sel1l	UTSW	12	91826684	missense	probably damaging	0.96
R2001:Sel1l	UTSW	12	91826550	nonsense	probably null
R3418:Sel1l	UTSW	12	91810002	missense	probably damaging	1.00
R3419:Sel1l	UTSW	12	91810002	missense	probably damaging	1.00
R4601:Sel1l	UTSW	12	91833053	critical splice donor site	probably null
R4776:Sel1l	UTSW	12	91813893	missense	probably damaging	1.00
R4839:Sel1l	UTSW	12	91833158	missense	probably benign	0.00
R4860:Sel1l	UTSW	12	91831602	missense	probably damaging	1.00
R4860:Sel1l	UTSW	12	91831602	missense	probably damaging	1.00
R4869:Sel1l	UTSW	12	91814054	intron	probably benign
R5261:Sel1l	UTSW	12	91824884	missense	possibly damaging	0.92
R5692:Sel1l	UTSW	12	91811878	missense	probably benign	0.02
R5744:Sel1l	UTSW	12	91809980	missense	possibly damaging	0.95
R5830:Sel1l	UTSW	12	91833171	missense	probably damaging	1.00
R6799:Sel1l	UTSW	12	91814968	splice site	probably null
R7291:Sel1l	UTSW	12	91848965	missense	probably benign
R8493:Sel1l	UTSW	12	91813961	nonsense	probably null
R9178:Sel1l	UTSW	12	91830752	missense	probably benign	0.05
R9179:Sel1l	UTSW	12	91811952	missense	probably benign	0.42
Z1176:Sel1l	UTSW	12	91825297	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- AGAATTCCAGAGGCACTGCTCTCC -3'
(R):5'- GTGAAGCAGCCCTGTCTTCTCTATG -3'

Sequencing Primer
(F):5'- GTGCATGTAGCCCAGGTTAA -3'
(R):5'- CTGTAACCTGCTTTCTGAGAAGAG -3'

Posted On

2014-04-13