Mutagenetix > Incidental Mutations

Incidental Mutation 'R1505:Rapgef5'

169132

Institutional Source

Beutler Lab

Gene Symbol

Rapgef5

Ensembl Gene

ENSMUSG00000041992

Gene Name

Rap guanine nucleotide exchange factor (GEF) 5

Synonyms

D030051B22Rik, mr-gef

MMRRC Submission

040868-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1505 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

117516479-117759737 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 117688619 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 79 (V79A)

Ref Sequence

ENSEMBL: ENSMUSP00000152875 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109691] [ENSMUST00000222105] [ENSMUST00000222185]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109691
AA Change: V281A

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000105313
Gene: ENSMUSG00000041992
AA Change: V281A

Domain	Start	End	E-Value	Type
DEP	44	118	2.07e-12	SMART
RasGEFN	300	434	3.12e-34	SMART
Blast:RasGEF	441	502	7e-31	BLAST
RasGEF	574	814	1.52e-100	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000222105
AA Change: V79A

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

probably benign
Transcript: ENSMUST00000222185

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223040

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.5%
20x: 86.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the RAS (see HRAS; MIM 190020) subfamily of GTPases function in signal transduction as GTP/GDP-regulated switches that cycle between inactive GDP- and active GTP-bound states. Guanine nucleotide exchange factors (GEFs), such as RAPGEF5, serve as RAS activators by promoting acquisition of GTP to maintain the active GTP-bound state and are the key link between cell surface receptors and RAS activation (Rebhun et al., 2000 [PubMed 10934204]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg3	T	A	5: 104,951,565	R444W	probably damaging	Het
Adnp	A	G	2: 168,183,741	S545P	possibly damaging	Het
Ankrd17	T	C	5: 90,300,026	R219G	possibly damaging	Het
Ap2m1	C	G	16: 20,542,697	P372A	probably benign	Het
Calml3	T	A	13: 3,804,071	T45S	probably benign	Het
Casp8	A	G	1: 58,828,922	E174G	probably damaging	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Cfap221	A	C	1: 119,953,628	L368R	probably benign	Het
Chd9	A	G	8: 91,006,495		probably null	Het
Cnot1	A	T	8: 95,728,667	I2035N	probably damaging	Het
Cyp2c67	T	C	19: 39,648,964	R23G	probably benign	Het
Dnah10	A	C	5: 124,754,239	H777P	possibly damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam162b	G	A	10: 51,587,202	A123V	probably damaging	Het
Golgb1	T	A	16: 36,919,643	N2781K	possibly damaging	Het
Hs2st1	C	A	3: 144,434,561	R333L	probably benign	Het
Kmt2e	A	G	5: 23,500,535	H1319R	probably null	Het
Necab1	A	T	4: 14,960,047	M300K	probably benign	Het
Ntrk3	T	A	7: 78,460,524	I321F	probably damaging	Het
Olfr228	A	T	2: 86,483,213	H176Q	possibly damaging	Het
Olfr484	A	G	7: 108,124,993	V90A	probably benign	Het
Olfr860	A	T	9: 19,845,788	M277K	probably benign	Het
Olfr965	A	G	9: 39,719,478	N84D	probably damaging	Het
Osbpl6	T	C	2: 76,579,242	S483P	probably damaging	Het
Pcdhb17	A	C	18: 37,486,822	N555T	probably damaging	Het
Pdgfc	G	A	3: 81,209,236	R299H	possibly damaging	Het
Ptpn7	A	T	1: 135,134,564	T83S	probably benign	Het
Rexo5	T	A	7: 119,799,603	C54*	probably null	Het
Riok3	A	G	18: 12,152,878	K418R	probably benign	Het
Robo4	G	A	9: 37,403,227	G170D	probably damaging	Het
Rpl8	A	G	15: 76,904,410	D33G	possibly damaging	Het
Rspo2	T	C	15: 43,075,843	T184A	probably damaging	Het
Ryr2	A	T	13: 11,554,592	M4942K	possibly damaging	Het
Sel1l	T	C	12: 91,813,962	Y585C	probably damaging	Het
Slc25a11	G	T	11: 70,646,824	D13E	probably benign	Het
Slc5a6	G	T	5: 31,037,111	H584N	probably benign	Het
Snrpf	A	G	10: 93,583,519	V69A	possibly damaging	Het
Sorbs3	T	A	14: 70,190,802	K475*	probably null	Het
Speg	G	A	1: 75,375,542	V35I	probably benign	Het
Tlk2	T	G	11: 105,260,295	V468G	probably damaging	Het
Trim6	T	A	7: 104,232,564	W341R	probably damaging	Het
Ttll5	T	A	12: 85,879,410	I326N	probably damaging	Het
Vipas39	T	C	12: 87,246,160	Y318C	probably damaging	Het
Vmn1r185	T	A	7: 26,611,478	I201F	probably damaging	Het
Vwce	A	G	19: 10,664,244	H778R	probably benign	Het
Zbtb14	C	G	17: 69,387,764	I152M	probably benign	Het

Other mutations in Rapgef5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Rapgef5	APN	12	117714182	missense	probably damaging	0.99
IGL01405:Rapgef5	APN	12	117721380	missense	probably benign	0.16
IGL01611:Rapgef5	APN	12	117753419	splice site	probably benign
IGL01720:Rapgef5	APN	12	117613435	splice site	probably benign
IGL01958:Rapgef5	APN	12	117730651	missense	probably benign	0.24
IGL02093:Rapgef5	APN	12	117719132	missense	probably damaging	0.98
IGL03210:Rapgef5	APN	12	117742872	missense	probably damaging	1.00
IGL03370:Rapgef5	APN	12	117730559	missense	probably damaging	1.00
IGL03397:Rapgef5	APN	12	117748441	missense	probably damaging	1.00
R0026:Rapgef5	UTSW	12	117689161	missense	probably benign	0.11
R0026:Rapgef5	UTSW	12	117689161	missense	probably benign	0.11
R0100:Rapgef5	UTSW	12	117721299	missense	probably benign	0.05
R0173:Rapgef5	UTSW	12	117688676	missense	probably benign	0.00
R0834:Rapgef5	UTSW	12	117647121	splice site	probably benign
R1331:Rapgef5	UTSW	12	117721349	missense	probably benign	0.04
R1546:Rapgef5	UTSW	12	117647101	missense	probably benign	0.00
R1577:Rapgef5	UTSW	12	117595291	missense	probably benign	0.28
R1597:Rapgef5	UTSW	12	117658320	missense	probably damaging	1.00
R1824:Rapgef5	UTSW	12	117688684	critical splice donor site	probably null
R2065:Rapgef5	UTSW	12	117584119	nonsense	probably null
R2117:Rapgef5	UTSW	12	117714064	intron	probably null
R2169:Rapgef5	UTSW	12	117715395	missense	probably benign	0.25
R2903:Rapgef5	UTSW	12	117714119	missense	probably damaging	1.00
R3983:Rapgef5	UTSW	12	117728670	missense	possibly damaging	0.49
R4004:Rapgef5	UTSW	12	117748397	missense	probably damaging	0.99
R4652:Rapgef5	UTSW	12	117714128	missense	probably damaging	0.99
R4830:Rapgef5	UTSW	12	117756074	missense	probably damaging	1.00
R5282:Rapgef5	UTSW	12	117739644	missense	probably damaging	1.00
R5348:Rapgef5	UTSW	12	117688611	missense	probably benign	0.24
R5456:Rapgef5	UTSW	12	117728646	splice site	probably null
R5502:Rapgef5	UTSW	12	117721329	missense	probably damaging	1.00
R5741:Rapgef5	UTSW	12	117756029	missense	probably damaging	0.99
R5771:Rapgef5	UTSW	12	117721326	missense	probably benign	0.45
R5905:Rapgef5	UTSW	12	117748426	missense	probably damaging	1.00
R5941:Rapgef5	UTSW	12	117728738	missense	probably damaging	1.00
R6228:Rapgef5	UTSW	12	117721663	intron	probably null
R6233:Rapgef5	UTSW	12	117739718	critical splice donor site	probably null
R6376:Rapgef5	UTSW	12	117721253	missense	probably damaging	1.00
R6475:Rapgef5	UTSW	12	117718207	missense	probably damaging	1.00
R7063:Rapgef5	UTSW	12	117689129	missense	possibly damaging	0.91
R7410:Rapgef5	UTSW	12	117721328	missense	probably damaging	1.00
R7445:Rapgef5	UTSW	12	117755969	missense	probably benign	0.00
R7690:Rapgef5	UTSW	12	117721370	missense	possibly damaging	0.72
R7707:Rapgef5	UTSW	12	117715344	missense	probably damaging	1.00
R7815:Rapgef5	UTSW	12	117755967	missense	probably benign	0.10
X0018:Rapgef5	UTSW	12	117718215	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCACTCACAGGTTGCTTTAGCATC -3'
(R):5'- CCTTTCACTGGGAACTGAGTCCATC -3'

Sequencing Primer
(F):5'- AGAGACCTTGAGCCTAGATTCTG -3'
(R):5'- ggagagaaaagagggaggagg -3'

Posted On

2014-04-13