Incidental Mutation 'R1505:Rspo2'
ID 169136
Institutional Source Beutler Lab
Gene Symbol Rspo2
Ensembl Gene ENSMUSG00000051920
Gene Name R-spondin 2
Synonyms 2610028F08Rik, ftls
MMRRC Submission 040868-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1505 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 43020794-43170826 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43075843 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 184 (T184A)
Ref Sequence ENSEMBL: ENSMUSP00000154600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063492] [ENSMUST00000226810]
AlphaFold Q8BFU0
Predicted Effect probably damaging
Transcript: ENSMUST00000063492
AA Change: T184A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067325
Gene: ENSMUSG00000051920
AA Change: T184A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FU 37 84 1.95e0 SMART
FU 90 134 3.7e-8 SMART
TSP1 147 204 7.45e-4 SMART
low complexity region 207 223 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226402
Predicted Effect probably damaging
Transcript: ENSMUST00000226810
AA Change: T184A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 86.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the R-spondin family of proteins. These proteins are secreted ligands of leucine-rich repeat containing G protein-coupled receptors that enhance Wnt signaling through the inhibition of ubiquitin E3 ligases. A chromosomal translocation including this locus that results in the formation of a gene fusion has been identified in multiple human cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mice display perinatal lethality, cleft palate, lung hypoplasia, asymmetric limb malformations and abnormal renal development. Heterozygous females display reduced fertility with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T A 5: 104,951,565 R444W probably damaging Het
Adnp A G 2: 168,183,741 S545P possibly damaging Het
Ankrd17 T C 5: 90,300,026 R219G possibly damaging Het
Ap2m1 C G 16: 20,542,697 P372A probably benign Het
Calml3 T A 13: 3,804,071 T45S probably benign Het
Casp8 A G 1: 58,828,922 E174G probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap221 A C 1: 119,953,628 L368R probably benign Het
Chd9 A G 8: 91,006,495 probably null Het
Cnot1 A T 8: 95,728,667 I2035N probably damaging Het
Cyp2c67 T C 19: 39,648,964 R23G probably benign Het
Dnah10 A C 5: 124,754,239 H777P possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam162b G A 10: 51,587,202 A123V probably damaging Het
Golgb1 T A 16: 36,919,643 N2781K possibly damaging Het
Hs2st1 C A 3: 144,434,561 R333L probably benign Het
Kmt2e A G 5: 23,500,535 H1319R probably null Het
Necab1 A T 4: 14,960,047 M300K probably benign Het
Ntrk3 T A 7: 78,460,524 I321F probably damaging Het
Olfr228 A T 2: 86,483,213 H176Q possibly damaging Het
Olfr484 A G 7: 108,124,993 V90A probably benign Het
Olfr860 A T 9: 19,845,788 M277K probably benign Het
Olfr965 A G 9: 39,719,478 N84D probably damaging Het
Osbpl6 T C 2: 76,579,242 S483P probably damaging Het
Pcdhb17 A C 18: 37,486,822 N555T probably damaging Het
Pdgfc G A 3: 81,209,236 R299H possibly damaging Het
Ptpn7 A T 1: 135,134,564 T83S probably benign Het
Rapgef5 T C 12: 117,688,619 V79A possibly damaging Het
Rexo5 T A 7: 119,799,603 C54* probably null Het
Riok3 A G 18: 12,152,878 K418R probably benign Het
Robo4 G A 9: 37,403,227 G170D probably damaging Het
Rpl8 A G 15: 76,904,410 D33G possibly damaging Het
Ryr2 A T 13: 11,554,592 M4942K possibly damaging Het
Sel1l T C 12: 91,813,962 Y585C probably damaging Het
Slc25a11 G T 11: 70,646,824 D13E probably benign Het
Slc5a6 G T 5: 31,037,111 H584N probably benign Het
Snrpf A G 10: 93,583,519 V69A possibly damaging Het
Sorbs3 T A 14: 70,190,802 K475* probably null Het
Speg G A 1: 75,375,542 V35I probably benign Het
Tlk2 T G 11: 105,260,295 V468G probably damaging Het
Trim6 T A 7: 104,232,564 W341R probably damaging Het
Ttll5 T A 12: 85,879,410 I326N probably damaging Het
Vipas39 T C 12: 87,246,160 Y318C probably damaging Het
Vmn1r185 T A 7: 26,611,478 I201F probably damaging Het
Vwce A G 19: 10,664,244 H778R probably benign Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Other mutations in Rspo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1866:Rspo2 UTSW 15 43075936 missense probably damaging 1.00
R2913:Rspo2 UTSW 15 43078114 missense probably benign 0.00
R4082:Rspo2 UTSW 15 43022537 missense probably benign
R4256:Rspo2 UTSW 15 43075911 missense probably benign 0.43
R4257:Rspo2 UTSW 15 43075911 missense probably benign 0.43
R4422:Rspo2 UTSW 15 43169754 missense probably benign
R4715:Rspo2 UTSW 15 43075904 nonsense probably null
R4810:Rspo2 UTSW 15 43169820 missense probably benign 0.24
R4829:Rspo2 UTSW 15 43093187 nonsense probably null
R5720:Rspo2 UTSW 15 43169814 missense probably benign 0.13
R5828:Rspo2 UTSW 15 43075887 missense probably damaging 1.00
R7487:Rspo2 UTSW 15 43078114 missense probably benign 0.25
R7571:Rspo2 UTSW 15 43169976 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCTGAGCACCATCTGCAAAGGC -3'
(R):5'- TGAAAAGTGGACACCCAACTGCTG -3'

Sequencing Primer
(F):5'- cacaacacacaacccacac -3'
(R):5'- ACACCCAACTGCTGTCTGTG -3'
Posted On 2014-04-13