Incidental Mutation 'R1505:Rpl8'
ID 169137
Institutional Source Beutler Lab
Gene Symbol Rpl8
Ensembl Gene ENSMUSG00000003970
Gene Name ribosomal protein L8
Synonyms
MMRRC Submission 040868-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock # R1505 (G1)
Quality Score 174
Status Not validated
Chromosome 15
Chromosomal Location 76904078-76906314 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 76904410 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 33 (D33G)
Ref Sequence ENSEMBL: ENSMUSP00000155657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004072] [ENSMUST00000068407] [ENSMUST00000109793] [ENSMUST00000229183] [ENSMUST00000230214]
AlphaFold P62918
Predicted Effect possibly damaging
Transcript: ENSMUST00000004072
AA Change: D33G

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000004072
Gene: ENSMUSG00000003970
AA Change: D33G

DomainStartEndE-ValueType
Ribosomal_L2 11 90 5.53e-33 SMART
Ribosomal_L2_C 96 231 6.56e-67 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068407
SMART Domains Protein: ENSMUSP00000069159
Gene: ENSMUSG00000055041

DomainStartEndE-ValueType
Pfam:HCaRG 37 214 5.3e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109793
SMART Domains Protein: ENSMUSP00000105416
Gene: ENSMUSG00000055041

DomainStartEndE-ValueType
Pfam:HCaRG 39 213 2.6e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000229183
AA Change: D33G

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229591
Predicted Effect probably benign
Transcript: ENSMUST00000230214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230815
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 86.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L2P family of ribosomal proteins. It is located in the cytoplasm. In rat, the protein associates with the 5.8S rRNA, very likely participates in the binding of aminoacyl-tRNA, and is a constituent of the elongation factor 2-binding site at the ribosomal subunit interface. Alternatively spliced transcript variants encoding the same protein exist. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T A 5: 104,951,565 R444W probably damaging Het
Adnp A G 2: 168,183,741 S545P possibly damaging Het
Ankrd17 T C 5: 90,300,026 R219G possibly damaging Het
Ap2m1 C G 16: 20,542,697 P372A probably benign Het
Calml3 T A 13: 3,804,071 T45S probably benign Het
Casp8 A G 1: 58,828,922 E174G probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap221 A C 1: 119,953,628 L368R probably benign Het
Chd9 A G 8: 91,006,495 probably null Het
Cnot1 A T 8: 95,728,667 I2035N probably damaging Het
Cyp2c67 T C 19: 39,648,964 R23G probably benign Het
Dnah10 A C 5: 124,754,239 H777P possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam162b G A 10: 51,587,202 A123V probably damaging Het
Golgb1 T A 16: 36,919,643 N2781K possibly damaging Het
Hs2st1 C A 3: 144,434,561 R333L probably benign Het
Kmt2e A G 5: 23,500,535 H1319R probably null Het
Necab1 A T 4: 14,960,047 M300K probably benign Het
Ntrk3 T A 7: 78,460,524 I321F probably damaging Het
Olfr228 A T 2: 86,483,213 H176Q possibly damaging Het
Olfr484 A G 7: 108,124,993 V90A probably benign Het
Olfr860 A T 9: 19,845,788 M277K probably benign Het
Olfr965 A G 9: 39,719,478 N84D probably damaging Het
Osbpl6 T C 2: 76,579,242 S483P probably damaging Het
Pcdhb17 A C 18: 37,486,822 N555T probably damaging Het
Pdgfc G A 3: 81,209,236 R299H possibly damaging Het
Ptpn7 A T 1: 135,134,564 T83S probably benign Het
Rapgef5 T C 12: 117,688,619 V79A possibly damaging Het
Rexo5 T A 7: 119,799,603 C54* probably null Het
Riok3 A G 18: 12,152,878 K418R probably benign Het
Robo4 G A 9: 37,403,227 G170D probably damaging Het
Rspo2 T C 15: 43,075,843 T184A probably damaging Het
Ryr2 A T 13: 11,554,592 M4942K possibly damaging Het
Sel1l T C 12: 91,813,962 Y585C probably damaging Het
Slc25a11 G T 11: 70,646,824 D13E probably benign Het
Slc5a6 G T 5: 31,037,111 H584N probably benign Het
Snrpf A G 10: 93,583,519 V69A possibly damaging Het
Sorbs3 T A 14: 70,190,802 K475* probably null Het
Speg G A 1: 75,375,542 V35I probably benign Het
Tlk2 T G 11: 105,260,295 V468G probably damaging Het
Trim6 T A 7: 104,232,564 W341R probably damaging Het
Ttll5 T A 12: 85,879,410 I326N probably damaging Het
Vipas39 T C 12: 87,246,160 Y318C probably damaging Het
Vmn1r185 T A 7: 26,611,478 I201F probably damaging Het
Vwce A G 19: 10,664,244 H778R probably benign Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Other mutations in Rpl8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Rpl8 APN 15 76905042 unclassified probably benign
R0398:Rpl8 UTSW 15 76905046 unclassified probably benign
R6852:Rpl8 UTSW 15 76905949 missense probably benign 0.01
Z1177:Rpl8 UTSW 15 76904397 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- ATCCGCCGCCGTTAACTACTTG -3'
(R):5'- TTGCCGCAGTACACGAACTGTC -3'

Sequencing Primer
(F):5'- CACTCGTCCAGGATCAGAAGG -3'
(R):5'- TACACGAACTGTCCAGTGTGG -3'
Posted On 2014-04-13