Incidental Mutation 'R1505:Ap2m1'
ID 169138
Institutional Source Beutler Lab
Gene Symbol Ap2m1
Ensembl Gene ENSMUSG00000022841
Gene Name adaptor-related protein complex 2, mu 1 subunit
Synonyms clathrin-associated AP-2
MMRRC Submission 040868-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1505 (G1)
Quality Score 178
Status Not validated
Chromosome 16
Chromosomal Location 20535478-20544909 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 20542697 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Alanine at position 372 (P372A)
Ref Sequence ENSEMBL: ENSMUSP00000087477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007216] [ENSMUST00000090023] [ENSMUST00000126788] [ENSMUST00000232001]
AlphaFold P84091
Predicted Effect probably benign
Transcript: ENSMUST00000007216
AA Change: P374A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000007216
Gene: ENSMUSG00000022841
AA Change: P374A

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 137 6.7e-8 PFAM
Pfam:Adap_comp_sub 159 435 3.2e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090023
AA Change: P372A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087477
Gene: ENSMUSG00000022841
AA Change: P372A

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 137 4.2e-8 PFAM
Pfam:Adap_comp_sub 157 433 8.7e-87 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119553
Predicted Effect probably benign
Transcript: ENSMUST00000126788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134981
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150986
Predicted Effect probably benign
Transcript: ENSMUST00000232001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231978
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 86.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the mu subunit of the clathrin adaptor protein complex AP-2. It mediates sorting of cargo proteins harboring Y-X-X-Phi motifs into clathrin-coated vesicles. Alternate splicing of this gene results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 2, 8 and 19. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a targeted deletion display embryonic lethality before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T A 5: 104,951,565 R444W probably damaging Het
Adnp A G 2: 168,183,741 S545P possibly damaging Het
Ankrd17 T C 5: 90,300,026 R219G possibly damaging Het
Calml3 T A 13: 3,804,071 T45S probably benign Het
Casp8 A G 1: 58,828,922 E174G probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap221 A C 1: 119,953,628 L368R probably benign Het
Chd9 A G 8: 91,006,495 probably null Het
Cnot1 A T 8: 95,728,667 I2035N probably damaging Het
Cyp2c67 T C 19: 39,648,964 R23G probably benign Het
Dnah10 A C 5: 124,754,239 H777P possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam162b G A 10: 51,587,202 A123V probably damaging Het
Golgb1 T A 16: 36,919,643 N2781K possibly damaging Het
Hs2st1 C A 3: 144,434,561 R333L probably benign Het
Kmt2e A G 5: 23,500,535 H1319R probably null Het
Necab1 A T 4: 14,960,047 M300K probably benign Het
Ntrk3 T A 7: 78,460,524 I321F probably damaging Het
Olfr228 A T 2: 86,483,213 H176Q possibly damaging Het
Olfr484 A G 7: 108,124,993 V90A probably benign Het
Olfr860 A T 9: 19,845,788 M277K probably benign Het
Olfr965 A G 9: 39,719,478 N84D probably damaging Het
Osbpl6 T C 2: 76,579,242 S483P probably damaging Het
Pcdhb17 A C 18: 37,486,822 N555T probably damaging Het
Pdgfc G A 3: 81,209,236 R299H possibly damaging Het
Ptpn7 A T 1: 135,134,564 T83S probably benign Het
Rapgef5 T C 12: 117,688,619 V79A possibly damaging Het
Rexo5 T A 7: 119,799,603 C54* probably null Het
Riok3 A G 18: 12,152,878 K418R probably benign Het
Robo4 G A 9: 37,403,227 G170D probably damaging Het
Rpl8 A G 15: 76,904,410 D33G possibly damaging Het
Rspo2 T C 15: 43,075,843 T184A probably damaging Het
Ryr2 A T 13: 11,554,592 M4942K possibly damaging Het
Sel1l T C 12: 91,813,962 Y585C probably damaging Het
Slc25a11 G T 11: 70,646,824 D13E probably benign Het
Slc5a6 G T 5: 31,037,111 H584N probably benign Het
Snrpf A G 10: 93,583,519 V69A possibly damaging Het
Sorbs3 T A 14: 70,190,802 K475* probably null Het
Speg G A 1: 75,375,542 V35I probably benign Het
Tlk2 T G 11: 105,260,295 V468G probably damaging Het
Trim6 T A 7: 104,232,564 W341R probably damaging Het
Ttll5 T A 12: 85,879,410 I326N probably damaging Het
Vipas39 T C 12: 87,246,160 Y318C probably damaging Het
Vmn1r185 T A 7: 26,611,478 I201F probably damaging Het
Vwce A G 19: 10,664,244 H778R probably benign Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Other mutations in Ap2m1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01718:Ap2m1 APN 16 20542194 unclassified probably benign
R0110:Ap2m1 UTSW 16 20542240 missense possibly damaging 0.67
R0390:Ap2m1 UTSW 16 20541099 missense probably damaging 0.98
R0450:Ap2m1 UTSW 16 20542240 missense possibly damaging 0.67
R0510:Ap2m1 UTSW 16 20542240 missense possibly damaging 0.67
R1386:Ap2m1 UTSW 16 20541229 missense probably damaging 1.00
R1728:Ap2m1 UTSW 16 20539338 missense probably damaging 0.99
R1729:Ap2m1 UTSW 16 20539338 missense probably damaging 0.99
R4433:Ap2m1 UTSW 16 20543384 missense possibly damaging 0.55
R5773:Ap2m1 UTSW 16 20543390 missense probably damaging 0.96
R6953:Ap2m1 UTSW 16 20542718 missense probably damaging 0.96
R7226:Ap2m1 UTSW 16 20539451 missense probably damaging 0.99
R7266:Ap2m1 UTSW 16 20543345 missense probably damaging 1.00
R7735:Ap2m1 UTSW 16 20539519 missense probably benign 0.01
R9571:Ap2m1 UTSW 16 20541287 missense probably damaging 1.00
R9777:Ap2m1 UTSW 16 20539363 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAAAGCGTACAGTCTGGGTGAGG -3'
(R):5'- TCAGGACACATCTGAAGCTGAGCC -3'

Sequencing Primer
(F):5'- TCTGGGTGAGGGAGAAACTG -3'
(R):5'- AATCCTTAGGTTGCCAGAGC -3'
Posted On 2014-04-13