Mutagenetix > Incidental Mutations

Incidental Mutation 'R1505:Ap2m1'

169138

Institutional Source

Beutler Lab

Gene Symbol

Ap2m1

Ensembl Gene

ENSMUSG00000022841

Gene Name

adaptor-related protein complex 2, mu 1 subunit

Synonyms

clathrin-associated AP-2

MMRRC Submission

040868-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1505 (G1)

Quality Score

178

Status

Not validated

Chromosome

Chromosomal Location

20535478-20544909 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 20542697 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Alanine at position 372 (P372A)

Ref Sequence

ENSEMBL: ENSMUSP00000087477 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000007216] [ENSMUST00000090023] [ENSMUST00000126788] [ENSMUST00000232001]

Predicted Effect

probably benign
Transcript: ENSMUST00000007216
AA Change: P374A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000007216
Gene: ENSMUSG00000022841
AA Change: P374A

Domain	Start	End	E-Value	Type
Pfam:Clat_adaptor_s	1	137	6.7e-8	PFAM
Pfam:Adap_comp_sub	159	435	3.2e-84	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000090023
AA Change: P372A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000087477
Gene: ENSMUSG00000022841
AA Change: P372A

Domain	Start	End	E-Value	Type
Pfam:Clat_adaptor_s	1	137	4.2e-8	PFAM
Pfam:Adap_comp_sub	157	433	8.7e-87	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000119553

Predicted Effect

probably benign
Transcript: ENSMUST00000126788

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131203

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133443

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134981

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135420

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148507

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150537

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150986

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231978

Predicted Effect

probably benign
Transcript: ENSMUST00000232001

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.5%
20x: 86.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes the mu subunit of the clathrin adaptor protein complex AP-2. It mediates sorting of cargo proteins harboring Y-X-X-Phi motifs into clathrin-coated vesicles. Alternate splicing of this gene results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 2, 8 and 19. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a targeted deletion display embryonic lethality before implantation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg3	T	A	5: 104,951,565	R444W	probably damaging	Het
Adnp	A	G	2: 168,183,741	S545P	possibly damaging	Het
Ankrd17	T	C	5: 90,300,026	R219G	possibly damaging	Het
Calml3	T	A	13: 3,804,071	T45S	probably benign	Het
Casp8	A	G	1: 58,828,922	E174G	probably damaging	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Cfap221	A	C	1: 119,953,628	L368R	probably benign	Het
Chd9	A	G	8: 91,006,495		probably null	Het
Cnot1	A	T	8: 95,728,667	I2035N	probably damaging	Het
Cyp2c67	T	C	19: 39,648,964	R23G	probably benign	Het
Dnah10	A	C	5: 124,754,239	H777P	possibly damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam162b	G	A	10: 51,587,202	A123V	probably damaging	Het
Golgb1	T	A	16: 36,919,643	N2781K	possibly damaging	Het
Hs2st1	C	A	3: 144,434,561	R333L	probably benign	Het
Kmt2e	A	G	5: 23,500,535	H1319R	probably null	Het
Necab1	A	T	4: 14,960,047	M300K	probably benign	Het
Ntrk3	T	A	7: 78,460,524	I321F	probably damaging	Het
Olfr228	A	T	2: 86,483,213	H176Q	possibly damaging	Het
Olfr484	A	G	7: 108,124,993	V90A	probably benign	Het
Olfr860	A	T	9: 19,845,788	M277K	probably benign	Het
Olfr965	A	G	9: 39,719,478	N84D	probably damaging	Het
Osbpl6	T	C	2: 76,579,242	S483P	probably damaging	Het
Pcdhb17	A	C	18: 37,486,822	N555T	probably damaging	Het
Pdgfc	G	A	3: 81,209,236	R299H	possibly damaging	Het
Ptpn7	A	T	1: 135,134,564	T83S	probably benign	Het
Rapgef5	T	C	12: 117,688,619	V79A	possibly damaging	Het
Rexo5	T	A	7: 119,799,603	C54*	probably null	Het
Riok3	A	G	18: 12,152,878	K418R	probably benign	Het
Robo4	G	A	9: 37,403,227	G170D	probably damaging	Het
Rpl8	A	G	15: 76,904,410	D33G	possibly damaging	Het
Rspo2	T	C	15: 43,075,843	T184A	probably damaging	Het
Ryr2	A	T	13: 11,554,592	M4942K	possibly damaging	Het
Sel1l	T	C	12: 91,813,962	Y585C	probably damaging	Het
Slc25a11	G	T	11: 70,646,824	D13E	probably benign	Het
Slc5a6	G	T	5: 31,037,111	H584N	probably benign	Het
Snrpf	A	G	10: 93,583,519	V69A	possibly damaging	Het
Sorbs3	T	A	14: 70,190,802	K475*	probably null	Het
Speg	G	A	1: 75,375,542	V35I	probably benign	Het
Tlk2	T	G	11: 105,260,295	V468G	probably damaging	Het
Trim6	T	A	7: 104,232,564	W341R	probably damaging	Het
Ttll5	T	A	12: 85,879,410	I326N	probably damaging	Het
Vipas39	T	C	12: 87,246,160	Y318C	probably damaging	Het
Vmn1r185	T	A	7: 26,611,478	I201F	probably damaging	Het
Vwce	A	G	19: 10,664,244	H778R	probably benign	Het
Zbtb14	C	G	17: 69,387,764	I152M	probably benign	Het

Other mutations in Ap2m1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01718:Ap2m1	APN	16	20542194	unclassified	probably benign
R0110:Ap2m1	UTSW	16	20542240	missense	possibly damaging	0.67
R0390:Ap2m1	UTSW	16	20541099	missense	probably damaging	0.98
R0450:Ap2m1	UTSW	16	20542240	missense	possibly damaging	0.67
R0510:Ap2m1	UTSW	16	20542240	missense	possibly damaging	0.67
R1386:Ap2m1	UTSW	16	20541229	missense	probably damaging	1.00
R1728:Ap2m1	UTSW	16	20539338	missense	probably damaging	0.99
R1729:Ap2m1	UTSW	16	20539338	missense	probably damaging	0.99
R4433:Ap2m1	UTSW	16	20543384	missense	possibly damaging	0.55
R5773:Ap2m1	UTSW	16	20543390	missense	probably damaging	0.96
R6953:Ap2m1	UTSW	16	20542718	missense	probably damaging	0.96
R7226:Ap2m1	UTSW	16	20539451	missense	probably damaging	0.99
R7266:Ap2m1	UTSW	16	20543345	missense	probably damaging	1.00
R7735:Ap2m1	UTSW	16	20539519	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TCTAAAGCGTACAGTCTGGGTGAGG -3'
(R):5'- TCAGGACACATCTGAAGCTGAGCC -3'

Sequencing Primer
(F):5'- TCTGGGTGAGGGAGAAACTG -3'
(R):5'- AATCCTTAGGTTGCCAGAGC -3'

Posted On

2014-04-13