Incidental Mutation 'R1505:Cyp2c67'
ID169144
Institutional Source Beutler Lab
Gene Symbol Cyp2c67
Ensembl Gene ENSMUSG00000062624
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 67
SynonymsC730004C24Rik
MMRRC Submission 040868-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R1505 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location39608842-39649051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39648964 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 23 (R23G)
Ref Sequence ENSEMBL: ENSMUSP00000065796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067328]
Predicted Effect probably benign
Transcript: ENSMUST00000067328
AA Change: R23G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000065796
Gene: ENSMUSG00000062624
AA Change: R23G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 8.5e-150 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 86.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T A 5: 104,951,565 R444W probably damaging Het
Adnp A G 2: 168,183,741 S545P possibly damaging Het
Ankrd17 T C 5: 90,300,026 R219G possibly damaging Het
Ap2m1 C G 16: 20,542,697 P372A probably benign Het
Calml3 T A 13: 3,804,071 T45S probably benign Het
Casp8 A G 1: 58,828,922 E174G probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap221 A C 1: 119,953,628 L368R probably benign Het
Chd9 A G 8: 91,006,495 probably null Het
Cnot1 A T 8: 95,728,667 I2035N probably damaging Het
Dnah10 A C 5: 124,754,239 H777P possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam162b G A 10: 51,587,202 A123V probably damaging Het
Golgb1 T A 16: 36,919,643 N2781K possibly damaging Het
Hs2st1 C A 3: 144,434,561 R333L probably benign Het
Kmt2e A G 5: 23,500,535 H1319R probably null Het
Necab1 A T 4: 14,960,047 M300K probably benign Het
Ntrk3 T A 7: 78,460,524 I321F probably damaging Het
Olfr228 A T 2: 86,483,213 H176Q possibly damaging Het
Olfr484 A G 7: 108,124,993 V90A probably benign Het
Olfr860 A T 9: 19,845,788 M277K probably benign Het
Olfr965 A G 9: 39,719,478 N84D probably damaging Het
Osbpl6 T C 2: 76,579,242 S483P probably damaging Het
Pcdhb17 A C 18: 37,486,822 N555T probably damaging Het
Pdgfc G A 3: 81,209,236 R299H possibly damaging Het
Ptpn7 A T 1: 135,134,564 T83S probably benign Het
Rapgef5 T C 12: 117,688,619 V79A possibly damaging Het
Rexo5 T A 7: 119,799,603 C54* probably null Het
Riok3 A G 18: 12,152,878 K418R probably benign Het
Robo4 G A 9: 37,403,227 G170D probably damaging Het
Rpl8 A G 15: 76,904,410 D33G possibly damaging Het
Rspo2 T C 15: 43,075,843 T184A probably damaging Het
Ryr2 A T 13: 11,554,592 M4942K possibly damaging Het
Sel1l T C 12: 91,813,962 Y585C probably damaging Het
Slc25a11 G T 11: 70,646,824 D13E probably benign Het
Slc5a6 G T 5: 31,037,111 H584N probably benign Het
Snrpf A G 10: 93,583,519 V69A possibly damaging Het
Sorbs3 T A 14: 70,190,802 K475* probably null Het
Speg G A 1: 75,375,542 V35I probably benign Het
Tlk2 T G 11: 105,260,295 V468G probably damaging Het
Trim6 T A 7: 104,232,564 W341R probably damaging Het
Ttll5 T A 12: 85,879,410 I326N probably damaging Het
Vipas39 T C 12: 87,246,160 Y318C probably damaging Het
Vmn1r185 T A 7: 26,611,478 I201F probably damaging Het
Vwce A G 19: 10,664,244 H778R probably benign Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Other mutations in Cyp2c67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Cyp2c67 APN 19 39643385 missense possibly damaging 0.95
IGL01025:Cyp2c67 APN 19 39639932 nonsense probably null
IGL01363:Cyp2c67 APN 19 39639967 missense probably damaging 0.99
IGL01819:Cyp2c67 APN 19 39615721 missense probably damaging 0.98
IGL01902:Cyp2c67 APN 19 39649026 missense probably damaging 1.00
IGL02172:Cyp2c67 APN 19 39649002 missense possibly damaging 0.76
IGL02351:Cyp2c67 APN 19 39617417 missense probably damaging 1.00
IGL02355:Cyp2c67 APN 19 39643405 missense probably benign 0.34
IGL02355:Cyp2c67 APN 19 39617382 nonsense probably null
IGL02358:Cyp2c67 APN 19 39617417 missense probably damaging 1.00
IGL02362:Cyp2c67 APN 19 39643405 missense probably benign 0.34
IGL02362:Cyp2c67 APN 19 39617382 nonsense probably null
IGL02388:Cyp2c67 APN 19 39643355 missense probably benign 0.20
IGL03106:Cyp2c67 APN 19 39643675 missense probably benign 0.27
IGL03219:Cyp2c67 APN 19 39643294 missense possibly damaging 0.54
IGL03326:Cyp2c67 APN 19 39643269 critical splice donor site probably null
IGL03349:Cyp2c67 APN 19 39643684 missense probably damaging 1.00
IGL03356:Cyp2c67 APN 19 39639961 missense probably damaging 1.00
IGL03052:Cyp2c67 UTSW 19 39648885 missense possibly damaging 0.88
R0585:Cyp2c67 UTSW 19 39638694 missense possibly damaging 0.59
R0975:Cyp2c67 UTSW 19 39609178 missense possibly damaging 0.49
R0976:Cyp2c67 UTSW 19 39643374 missense probably damaging 1.00
R1252:Cyp2c67 UTSW 19 39626141 missense possibly damaging 0.93
R1398:Cyp2c67 UTSW 19 39638625 missense probably damaging 0.96
R1411:Cyp2c67 UTSW 19 39638591 missense probably damaging 1.00
R1543:Cyp2c67 UTSW 19 39643264 splice site probably benign
R1613:Cyp2c67 UTSW 19 39626199 missense probably benign 0.00
R1618:Cyp2c67 UTSW 19 39643264 splice site probably benign
R1667:Cyp2c67 UTSW 19 39643590 critical splice donor site probably null
R1852:Cyp2c67 UTSW 19 39617367 missense probably benign 0.01
R2005:Cyp2c67 UTSW 19 39643345 missense probably damaging 1.00
R2105:Cyp2c67 UTSW 19 39626237 missense probably benign 0.24
R2181:Cyp2c67 UTSW 19 39609097 missense possibly damaging 0.94
R3817:Cyp2c67 UTSW 19 39638683 missense probably benign 0.00
R4669:Cyp2c67 UTSW 19 39643654 missense probably benign 0.00
R4689:Cyp2c67 UTSW 19 39638588 missense probably benign 0.00
R4756:Cyp2c67 UTSW 19 39643744 missense probably benign 0.03
R4823:Cyp2c67 UTSW 19 39615724 missense probably benign 0.13
R5152:Cyp2c67 UTSW 19 39638688 missense probably benign 0.00
R5345:Cyp2c67 UTSW 19 39626232 missense probably benign 0.01
R5580:Cyp2c67 UTSW 19 39615650 missense probably damaging 0.99
R5644:Cyp2c67 UTSW 19 39615694 missense possibly damaging 0.84
R6116:Cyp2c67 UTSW 19 39617435 missense probably damaging 1.00
R6516:Cyp2c67 UTSW 19 39617429 missense probably damaging 1.00
R6550:Cyp2c67 UTSW 19 39617410 nonsense probably null
R6939:Cyp2c67 UTSW 19 39643334 missense possibly damaging 0.68
R6995:Cyp2c67 UTSW 19 39615679 missense probably damaging 0.96
R7028:Cyp2c67 UTSW 19 39639897 missense possibly damaging 0.68
R7144:Cyp2c67 UTSW 19 39615694 missense probably benign 0.00
R7242:Cyp2c67 UTSW 19 39617339 missense probably benign 0.30
R7335:Cyp2c67 UTSW 19 39640007 nonsense probably null
R7337:Cyp2c67 UTSW 19 39609264 splice site probably null
R7474:Cyp2c67 UTSW 19 39617432 missense probably null 0.05
R7642:Cyp2c67 UTSW 19 39615640 missense probably damaging 0.97
R7870:Cyp2c67 UTSW 19 39609225 missense probably damaging 1.00
R7953:Cyp2c67 UTSW 19 39609225 missense probably damaging 1.00
Z1177:Cyp2c67 UTSW 19 39643679 missense not run
Predicted Primers PCR Primer
(F):5'- tcggaggaccaacaacaCAAAATAATAGAA -3'
(R):5'- CCCAAATGTCTTACAGGCACTCTACAA -3'

Sequencing Primer
(F):5'- GAGTCTTCAATCTGAAACTTAGAGC -3'
(R):5'- TTGAGACAAAGTCCATTTGGAAGC -3'
Posted On2014-04-13