Mutagenetix > Incidental Mutations

Incidental Mutation 'R1505:Cyp2c67'

169144

Institutional Source

Beutler Lab

Gene Symbol

Cyp2c67

Ensembl Gene

ENSMUSG00000062624

Gene Name

cytochrome P450, family 2, subfamily c, polypeptide 67

Synonyms

C730004C24Rik

MMRRC Submission

040868-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.082) question?

Stock #

R1505 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

39608842-39649051 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 39648964 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 23 (R23G)

Ref Sequence

ENSEMBL: ENSMUSP00000065796 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067328]

Predicted Effect

probably benign
Transcript: ENSMUST00000067328
AA Change: R23G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000065796
Gene: ENSMUSG00000062624
AA Change: R23G

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:p450	30	487	8.5e-150	PFAM

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.5%
20x: 86.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg3	T	A	5: 104,951,565	R444W	probably damaging	Het
Adnp	A	G	2: 168,183,741	S545P	possibly damaging	Het
Ankrd17	T	C	5: 90,300,026	R219G	possibly damaging	Het
Ap2m1	C	G	16: 20,542,697	P372A	probably benign	Het
Calml3	T	A	13: 3,804,071	T45S	probably benign	Het
Casp8	A	G	1: 58,828,922	E174G	probably damaging	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Cfap221	A	C	1: 119,953,628	L368R	probably benign	Het
Chd9	A	G	8: 91,006,495		probably null	Het
Cnot1	A	T	8: 95,728,667	I2035N	probably damaging	Het
Dnah10	A	C	5: 124,754,239	H777P	possibly damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam162b	G	A	10: 51,587,202	A123V	probably damaging	Het
Golgb1	T	A	16: 36,919,643	N2781K	possibly damaging	Het
Hs2st1	C	A	3: 144,434,561	R333L	probably benign	Het
Kmt2e	A	G	5: 23,500,535	H1319R	probably null	Het
Necab1	A	T	4: 14,960,047	M300K	probably benign	Het
Ntrk3	T	A	7: 78,460,524	I321F	probably damaging	Het
Olfr228	A	T	2: 86,483,213	H176Q	possibly damaging	Het
Olfr484	A	G	7: 108,124,993	V90A	probably benign	Het
Olfr860	A	T	9: 19,845,788	M277K	probably benign	Het
Olfr965	A	G	9: 39,719,478	N84D	probably damaging	Het
Osbpl6	T	C	2: 76,579,242	S483P	probably damaging	Het
Pcdhb17	A	C	18: 37,486,822	N555T	probably damaging	Het
Pdgfc	G	A	3: 81,209,236	R299H	possibly damaging	Het
Ptpn7	A	T	1: 135,134,564	T83S	probably benign	Het
Rapgef5	T	C	12: 117,688,619	V79A	possibly damaging	Het
Rexo5	T	A	7: 119,799,603	C54*	probably null	Het
Riok3	A	G	18: 12,152,878	K418R	probably benign	Het
Robo4	G	A	9: 37,403,227	G170D	probably damaging	Het
Rpl8	A	G	15: 76,904,410	D33G	possibly damaging	Het
Rspo2	T	C	15: 43,075,843	T184A	probably damaging	Het
Ryr2	A	T	13: 11,554,592	M4942K	possibly damaging	Het
Sel1l	T	C	12: 91,813,962	Y585C	probably damaging	Het
Slc25a11	G	T	11: 70,646,824	D13E	probably benign	Het
Slc5a6	G	T	5: 31,037,111	H584N	probably benign	Het
Snrpf	A	G	10: 93,583,519	V69A	possibly damaging	Het
Sorbs3	T	A	14: 70,190,802	K475*	probably null	Het
Speg	G	A	1: 75,375,542	V35I	probably benign	Het
Tlk2	T	G	11: 105,260,295	V468G	probably damaging	Het
Trim6	T	A	7: 104,232,564	W341R	probably damaging	Het
Ttll5	T	A	12: 85,879,410	I326N	probably damaging	Het
Vipas39	T	C	12: 87,246,160	Y318C	probably damaging	Het
Vmn1r185	T	A	7: 26,611,478	I201F	probably damaging	Het
Vwce	A	G	19: 10,664,244	H778R	probably benign	Het
Zbtb14	C	G	17: 69,387,764	I152M	probably benign	Het

Other mutations in Cyp2c67

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00955:Cyp2c67	APN	19	39643385	missense	possibly damaging	0.95
IGL01025:Cyp2c67	APN	19	39639932	nonsense	probably null
IGL01363:Cyp2c67	APN	19	39639967	missense	probably damaging	0.99
IGL01819:Cyp2c67	APN	19	39615721	missense	probably damaging	0.98
IGL01902:Cyp2c67	APN	19	39649026	missense	probably damaging	1.00
IGL02172:Cyp2c67	APN	19	39649002	missense	possibly damaging	0.76
IGL02351:Cyp2c67	APN	19	39617417	missense	probably damaging	1.00
IGL02355:Cyp2c67	APN	19	39643405	missense	probably benign	0.34
IGL02355:Cyp2c67	APN	19	39617382	nonsense	probably null
IGL02358:Cyp2c67	APN	19	39617417	missense	probably damaging	1.00
IGL02362:Cyp2c67	APN	19	39643405	missense	probably benign	0.34
IGL02362:Cyp2c67	APN	19	39617382	nonsense	probably null
IGL02388:Cyp2c67	APN	19	39643355	missense	probably benign	0.20
IGL03106:Cyp2c67	APN	19	39643675	missense	probably benign	0.27
IGL03219:Cyp2c67	APN	19	39643294	missense	possibly damaging	0.54
IGL03326:Cyp2c67	APN	19	39643269	critical splice donor site	probably null
IGL03349:Cyp2c67	APN	19	39643684	missense	probably damaging	1.00
IGL03356:Cyp2c67	APN	19	39639961	missense	probably damaging	1.00
IGL03052:Cyp2c67	UTSW	19	39648885	missense	possibly damaging	0.88
R0585:Cyp2c67	UTSW	19	39638694	missense	possibly damaging	0.59
R0975:Cyp2c67	UTSW	19	39609178	missense	possibly damaging	0.49
R0976:Cyp2c67	UTSW	19	39643374	missense	probably damaging	1.00
R1252:Cyp2c67	UTSW	19	39626141	missense	possibly damaging	0.93
R1398:Cyp2c67	UTSW	19	39638625	missense	probably damaging	0.96
R1411:Cyp2c67	UTSW	19	39638591	missense	probably damaging	1.00
R1543:Cyp2c67	UTSW	19	39643264	splice site	probably benign
R1613:Cyp2c67	UTSW	19	39626199	missense	probably benign	0.00
R1618:Cyp2c67	UTSW	19	39643264	splice site	probably benign
R1667:Cyp2c67	UTSW	19	39643590	critical splice donor site	probably null
R1852:Cyp2c67	UTSW	19	39617367	missense	probably benign	0.01
R2005:Cyp2c67	UTSW	19	39643345	missense	probably damaging	1.00
R2105:Cyp2c67	UTSW	19	39626237	missense	probably benign	0.24
R2181:Cyp2c67	UTSW	19	39609097	missense	possibly damaging	0.94
R3817:Cyp2c67	UTSW	19	39638683	missense	probably benign	0.00
R4669:Cyp2c67	UTSW	19	39643654	missense	probably benign	0.00
R4689:Cyp2c67	UTSW	19	39638588	missense	probably benign	0.00
R4756:Cyp2c67	UTSW	19	39643744	missense	probably benign	0.03
R4823:Cyp2c67	UTSW	19	39615724	missense	probably benign	0.13
R5152:Cyp2c67	UTSW	19	39638688	missense	probably benign	0.00
R5345:Cyp2c67	UTSW	19	39626232	missense	probably benign	0.01
R5580:Cyp2c67	UTSW	19	39615650	missense	probably damaging	0.99
R5644:Cyp2c67	UTSW	19	39615694	missense	possibly damaging	0.84
R6116:Cyp2c67	UTSW	19	39617435	missense	probably damaging	1.00
R6516:Cyp2c67	UTSW	19	39617429	missense	probably damaging	1.00
R6550:Cyp2c67	UTSW	19	39617410	nonsense	probably null
R6939:Cyp2c67	UTSW	19	39643334	missense	possibly damaging	0.68
R6995:Cyp2c67	UTSW	19	39615679	missense	probably damaging	0.96
R7028:Cyp2c67	UTSW	19	39639897	missense	possibly damaging	0.68
R7144:Cyp2c67	UTSW	19	39615694	missense	probably benign	0.00
R7242:Cyp2c67	UTSW	19	39617339	missense	probably benign	0.30
R7335:Cyp2c67	UTSW	19	39640007	nonsense	probably null
R7337:Cyp2c67	UTSW	19	39609264	splice site	probably null
R7474:Cyp2c67	UTSW	19	39617432	missense	probably null	0.05
R7642:Cyp2c67	UTSW	19	39615640	missense	probably damaging	0.97
R7870:Cyp2c67	UTSW	19	39609225	missense	probably damaging	1.00
R8152:Cyp2c67	UTSW	19	39640008	missense	probably benign	0.21
R8367:Cyp2c67	UTSW	19	39638674	missense	probably benign	0.01
R8728:Cyp2c67	UTSW	19	39626161	missense	probably damaging	1.00
Z1177:Cyp2c67	UTSW	19	39643679	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- tcggaggaccaacaacaCAAAATAATAGAA -3'
(R):5'- CCCAAATGTCTTACAGGCACTCTACAA -3'

Sequencing Primer
(F):5'- GAGTCTTCAATCTGAAACTTAGAGC -3'
(R):5'- TTGAGACAAAGTCCATTTGGAAGC -3'

Posted On

2014-04-13