Incidental Mutation 'R1500:Marveld3'
Institutional Source Beutler Lab
Gene Symbol Marveld3
Ensembl Gene ENSMUSG00000001672
Gene NameMARVEL (membrane-associating) domain containing 3
Synonyms1810006A16Rik, MARVD3, Mrvldc3
MMRRC Submission 039551-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R1500 (G1)
Quality Score225
Status Validated
Chromosomal Location109947914-109962203 bp(-) (GRCm38)
Type of Mutationsplice site (3872 bp from exon)
DNA Base Change (assembly) T to G at 109948542 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001722] [ENSMUST00000034175] [ENSMUST00000051430] [ENSMUST00000179721]
Predicted Effect probably damaging
Transcript: ENSMUST00000001722
AA Change: N214T

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000001722
Gene: ENSMUSG00000001672
AA Change: N214T

low complexity region 7 33 N/A INTRINSIC
low complexity region 43 74 N/A INTRINSIC
low complexity region 104 116 N/A INTRINSIC
transmembrane domain 181 203 N/A INTRINSIC
transmembrane domain 239 261 N/A INTRINSIC
transmembrane domain 274 296 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000034175
SMART Domains Protein: ENSMUSP00000034175
Gene: ENSMUSG00000031732

low complexity region 40 57 N/A INTRINSIC
Blast:PH 148 247 3e-61 BLAST
LRR 295 314 1.12e2 SMART
Pfam:LRR_7 319 335 3.5e-2 PFAM
LRR 341 363 2.82e0 SMART
LRR 364 387 9.75e0 SMART
LRR 456 479 2.68e1 SMART
LRR 498 517 1.35e1 SMART
LRR 521 540 5.59e1 SMART
LRR 544 563 2.79e1 SMART
LRR 569 589 1.62e1 SMART
LRR 590 609 1.67e1 SMART
LRR 616 641 1.33e2 SMART
LRR 640 659 1.4e1 SMART
LRR_TYP 664 687 6.78e-3 SMART
LRR 709 733 2.15e2 SMART
PP2Cc 772 1028 2.98e-30 SMART
low complexity region 1061 1095 N/A INTRINSIC
Blast:PP2Cc 1109 1175 8e-15 BLAST
low complexity region 1297 1315 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051430
SMART Domains Protein: ENSMUSP00000052309
Gene: ENSMUSG00000001672

low complexity region 7 33 N/A INTRINSIC
low complexity region 43 74 N/A INTRINSIC
low complexity region 104 116 N/A INTRINSIC
Pfam:MARVEL 168 355 3.2e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000179721
SMART Domains Protein: ENSMUSP00000136166
Gene: ENSMUSG00000031732

low complexity region 2 28 N/A INTRINSIC
low complexity region 75 92 N/A INTRINSIC
Blast:PH 183 282 4e-61 BLAST
LRR 330 349 1.12e2 SMART
LRR 376 398 2.82e0 SMART
LRR 399 422 9.75e0 SMART
LRR 491 514 2.68e1 SMART
LRR 533 552 1.35e1 SMART
LRR 556 575 5.59e1 SMART
LRR 579 598 2.79e1 SMART
LRR 604 624 1.62e1 SMART
LRR 625 644 1.67e1 SMART
LRR 651 676 1.33e2 SMART
LRR 675 694 1.4e1 SMART
LRR_TYP 699 722 6.78e-3 SMART
LRR 744 768 2.15e2 SMART
PP2Cc 807 1063 2.98e-30 SMART
low complexity region 1096 1130 N/A INTRINSIC
Blast:PP2Cc 1144 1210 8e-15 BLAST
low complexity region 1332 1350 N/A INTRINSIC
Meta Mutation Damage Score 0.1572 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.1%
Validation Efficiency 95% (81/85)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik C A 11: 78,284,132 Q1698K possibly damaging Het
Abcg1 A G 17: 31,111,279 D518G probably benign Het
Acaca T A 11: 84,293,984 D96E probably benign Het
Actbl2 G A 13: 111,255,320 R63Q probably damaging Het
Adamts6 T A 13: 104,312,881 H266Q probably damaging Het
Aff4 T C 11: 53,372,378 V75A probably benign Het
Ank2 A G 3: 126,932,982 S888P probably benign Het
Ano7 T C 1: 93,397,328 F534S probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Bcam T A 7: 19,758,964 D484V possibly damaging Het
Ccdc88a T C 11: 29,482,713 Y1240H probably benign Het
Cfh T C 1: 140,100,876 Y500C probably damaging Het
Chd1l G A 3: 97,582,805 A478V probably benign Het
Dnah1 T C 14: 31,316,758 D122G probably benign Het
Dnah11 A T 12: 118,012,829 probably null Het
Dnah17 T C 11: 118,101,053 K1230E probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
E330020D12Rik A T 1: 153,408,379 noncoding transcript Het
Ece2 T C 16: 20,644,242 L639P probably damaging Het
Epha3 A T 16: 63,595,662 V658E probably benign Het
Erbb2 C T 11: 98,428,978 T632I probably damaging Het
Erc2 A G 14: 28,271,660 T883A probably damaging Het
Extl2 T C 3: 116,027,140 V198A probably benign Het
Fktn G T 4: 53,735,065 M234I probably benign Het
Ggt7 A G 2: 155,499,046 S400P probably benign Het
Gldc A C 19: 30,113,825 V790G possibly damaging Het
Gm14496 A C 2: 181,991,233 Q3P probably benign Het
H2-D1 G A 17: 35,263,588 E95K probably benign Het
Ikzf3 T C 11: 98,518,695 E14G probably benign Het
Jag1 A T 2: 137,115,638 N51K possibly damaging Het
Khdrbs3 A G 15: 68,928,786 D14G possibly damaging Het
Krt84 A G 15: 101,530,224 V276A probably damaging Het
Lamb1 T C 12: 31,298,949 I660T possibly damaging Het
Lcmt2 A T 2: 121,140,007 S198R probably benign Het
Lcn6 G A 2: 25,677,119 R44H probably benign Het
Lrfn5 A T 12: 61,839,741 H105L probably damaging Het
Lrit1 G A 14: 37,062,134 R473K probably benign Het
March1 A G 8: 66,468,390 T495A probably damaging Het
Mbd3 T C 10: 80,394,586 D160G possibly damaging Het
Mrc2 T G 11: 105,347,725 C1233G probably damaging Het
Ms4a13 T G 19: 11,183,861 T105P probably damaging Het
Mtbp T C 15: 55,617,555 Y306H probably damaging Het
Muc3a T C 5: 137,210,501 probably benign Het
Myo1g T A 11: 6,520,811 Y15F probably benign Het
Nae1 A T 8: 104,523,584 Y226N probably benign Het
Nlrp9a A G 7: 26,567,891 S715G probably benign Het
Olfr1193 T A 2: 88,677,875 S7T possibly damaging Het
Olfr338 A T 2: 36,377,621 M282L probably benign Het
Olfr699 T C 7: 106,790,821 Y60C probably damaging Het
Olfr844 A T 9: 19,319,316 S267C probably damaging Het
Olfr972 G T 9: 39,873,411 M45I probably benign Het
Pex5l T C 3: 33,014,980 T123A probably damaging Het
Pip5kl1 A T 2: 32,576,679 N62I probably benign Het
Pkhd1l1 T C 15: 44,545,494 V2459A probably damaging Het
Prb1 T A 6: 132,207,476 Q398L unknown Het
Prkab2 T C 3: 97,663,947 L165S probably damaging Het
Prl3d2 C G 13: 27,121,706 probably benign Het
Ptdss1 G A 13: 66,995,408 G435D probably benign Het
Qrfpr A G 3: 36,182,580 L224P probably damaging Het
Rasl2-9 C T 7: 5,125,442 W163* probably null Het
Rgs5 A G 1: 169,690,414 probably null Het
Rnf19b T C 4: 129,078,961 L255P probably damaging Het
Rp9 A C 9: 22,457,455 N69K probably damaging Het
Sh3bp4 G T 1: 89,145,488 S686I probably damaging Het
Spp2 C A 1: 88,412,293 Q5K possibly damaging Het
Svep1 C T 4: 58,070,239 G2516R probably damaging Het
Syncrip A C 9: 88,479,896 S55R probably damaging Het
Tacc3 T C 5: 33,661,308 L29P probably damaging Het
Tex15 A G 8: 33,575,092 T1517A probably damaging Het
Tmem140 A G 6: 34,872,725 M59V probably benign Het
Ttn G T 2: 76,745,528 A25007E probably damaging Het
Ubr2 T C 17: 46,986,689 T253A possibly damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Usp38 A G 8: 80,995,770 L374P probably damaging Het
Vmn1r42 T A 6: 89,845,501 I29L probably benign Het
Vmn2r94 C T 17: 18,256,980 V390M probably benign Het
Vmp1 A G 11: 86,661,200 Y113H possibly damaging Het
Wdr20 T C 12: 110,794,030 M450T probably benign Het
Ylpm1 T C 12: 85,014,996 V557A unknown Het
Zpld1 T C 16: 55,233,572 N286D probably damaging Het
Other mutations in Marveld3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Marveld3 APN 8 109961964 missense possibly damaging 0.81
IGL01341:Marveld3 APN 8 109948417 missense possibly damaging 0.94
IGL01415:Marveld3 APN 8 109962073 missense possibly damaging 0.92
IGL01759:Marveld3 APN 8 109948087 missense possibly damaging 0.90
IGL02012:Marveld3 APN 8 109948132 missense probably damaging 0.99
R0732:Marveld3 UTSW 8 109948483 missense probably damaging 0.99
R1955:Marveld3 UTSW 8 109959748 missense probably benign 0.08
R2146:Marveld3 UTSW 8 109959802 missense probably benign 0.00
R2172:Marveld3 UTSW 8 109961846 missense probably benign 0.22
R4843:Marveld3 UTSW 8 109962070 missense possibly damaging 0.66
R4925:Marveld3 UTSW 8 109948311 missense probably benign 0.00
R5542:Marveld3 UTSW 8 109948617 missense probably benign 0.03
R6003:Marveld3 UTSW 8 109954328 missense probably damaging 1.00
R6733:Marveld3 UTSW 8 109962049 missense possibly damaging 0.90
R6786:Marveld3 UTSW 8 109948100 missense probably benign 0.13
R7156:Marveld3 UTSW 8 109948188 missense probably damaging 1.00
R7194:Marveld3 UTSW 8 109959845 splice site probably null
R7429:Marveld3 UTSW 8 109948468 missense possibly damaging 0.77
R7430:Marveld3 UTSW 8 109948468 missense possibly damaging 0.77
R7810:Marveld3 UTSW 8 109954634 missense probably damaging 0.99
R8421:Marveld3 UTSW 8 109948647 missense probably benign 0.07
R8460:Marveld3 UTSW 8 109954408 missense probably benign 0.16
R8478:Marveld3 UTSW 8 109961968 missense probably damaging 1.00
Z1088:Marveld3 UTSW 8 109948063 missense possibly damaging 0.94
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- cctaagttcaattcctagcaacc -3'
Posted On2014-04-13