Mutagenetix > Incidental Mutations

Incidental Mutation 'R1500:Aff4'

169195

Institutional Source

Beutler Lab

Gene Symbol

Aff4

Ensembl Gene

ENSMUSG00000049470

Gene Name

AF4/FMR2 family, member 4

Synonyms

Laf4l, Alf4

MMRRC Submission

039551-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1500 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

53350833-53421830 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 53372378 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 75 (V75A)

Ref Sequence

ENSEMBL: ENSMUSP00000051479 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060945] [ENSMUST00000153821]

Predicted Effect

probably benign
Transcript: ENSMUST00000060945
AA Change: V75A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000051479
Gene: ENSMUSG00000049470
AA Change: V75A

Domain	Start	End	E-Value	Type
Pfam:AF-4	2	1156	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130152

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136470

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139054

Predicted Effect

probably benign
Transcript: ENSMUST00000152616

SMART Domains

Protein: ENSMUSP00000118866
Gene: ENSMUSG00000049470

Domain	Start	End	E-Value	Type
Pfam:AF-4	1	51	4e-15	PFAM
Pfam:AF-4	46	159	1.3e-30	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000153821
AA Change: V75A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000120613
Gene: ENSMUSG00000049470
AA Change: V75A

Domain	Start	End	E-Value	Type
Pfam:AF-4	2	122	4.1e-60	PFAM

Meta Mutation Damage Score

0.0916

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.7%
20x: 87.1%

Validation Efficiency

95% (81/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AF4 family of transcription factors involved in leukemia. It is a component of the positive transcription elongation factor b (P-TEFb) complex. A chromosomal translocation involving this gene and MLL gene on chromosome 11 is found in infant acute lymphoblastic leukemia with ins(5;11)(q31;q31q23). [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display embryonic and neonatal lethality with incomplete penetrance, abnormal respiration, and shrunken alveoli. Surviving males are infertile with azoospermia and arrest of spermatogenesis but, do not develop hematological abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	C	A	11: 78,284,132	Q1698K	possibly damaging	Het
A230050P20Rik	AGAGGAGGAGGAGGAGGAGGAGGAGGA	AGAGGAGGAGGAGGAGGAGGAGGA	9: 20,873,717		probably benign	Het
Abcg1	A	G	17: 31,111,279	D518G	probably benign	Het
Acaca	T	A	11: 84,293,984	D96E	probably benign	Het
Actbl2	G	A	13: 111,255,320	R63Q	probably damaging	Het
Adamts6	T	A	13: 104,312,881	H266Q	probably damaging	Het
Ank2	A	G	3: 126,932,982	S888P	probably benign	Het
Ano7	T	C	1: 93,397,328	F534S	probably damaging	Het
Arhgef6	T	C	X: 57,338,562	M5V	probably benign	Het
Bcam	T	A	7: 19,758,964	D484V	possibly damaging	Het
Ccdc88a	T	C	11: 29,482,713	Y1240H	probably benign	Het
Cfh	T	C	1: 140,100,876	Y500C	probably damaging	Het
Chd1l	G	A	3: 97,582,805	A478V	probably benign	Het
Dnah1	T	C	14: 31,316,758	D122G	probably benign	Het
Dnah11	A	T	12: 118,012,829		probably null	Het
Dnah17	T	C	11: 118,101,053	K1230E	probably benign	Het
Dync1h1	G	A	12: 110,636,509	E2195K	probably benign	Het
E330020D12Rik	A	T	1: 153,408,379		noncoding transcript	Het
Ece2	T	C	16: 20,644,242	L639P	probably damaging	Het
Epha3	A	T	16: 63,595,662	V658E	probably benign	Het
Erbb2	C	T	11: 98,428,978	T632I	probably damaging	Het
Erc2	A	G	14: 28,271,660	T883A	probably damaging	Het
Extl2	T	C	3: 116,027,140	V198A	probably benign	Het
Fktn	G	T	4: 53,735,065	M234I	probably benign	Het
Ggt7	A	G	2: 155,499,046	S400P	probably benign	Het
Gldc	A	C	19: 30,113,825	V790G	possibly damaging	Het
Gm14496	A	C	2: 181,991,233	Q3P	probably benign	Het
H2-D1	G	A	17: 35,263,588	E95K	probably benign	Het
Ikzf3	T	C	11: 98,518,695	E14G	probably benign	Het
Jag1	A	T	2: 137,115,638	N51K	possibly damaging	Het
Khdrbs3	A	G	15: 68,928,786	D14G	possibly damaging	Het
Krt84	A	G	15: 101,530,224	V276A	probably damaging	Het
Lamb1	T	C	12: 31,298,949	I660T	possibly damaging	Het
Lcmt2	A	T	2: 121,140,007	S198R	probably benign	Het
Lcn6	G	A	2: 25,677,119	R44H	probably benign	Het
Lrfn5	A	T	12: 61,839,741	H105L	probably damaging	Het
Lrit1	G	A	14: 37,062,134	R473K	probably benign	Het
March1	A	G	8: 66,468,390	T495A	probably damaging	Het
Marveld3	T	G	8: 109,948,542		probably null	Het
Mbd3	T	C	10: 80,394,586	D160G	possibly damaging	Het
Mrc2	T	G	11: 105,347,725	C1233G	probably damaging	Het
Ms4a13	T	G	19: 11,183,861	T105P	probably damaging	Het
Mtbp	T	C	15: 55,617,555	Y306H	probably damaging	Het
Muc3a	T	C	5: 137,210,501		probably benign	Het
Myo1g	T	A	11: 6,520,811	Y15F	probably benign	Het
Nae1	A	T	8: 104,523,584	Y226N	probably benign	Het
Nlrp9a	A	G	7: 26,567,891	S715G	probably benign	Het
Olfr1193	T	A	2: 88,677,875	S7T	possibly damaging	Het
Olfr338	A	T	2: 36,377,621	M282L	probably benign	Het
Olfr699	T	C	7: 106,790,821	Y60C	probably damaging	Het
Olfr844	A	T	9: 19,319,316	S267C	probably damaging	Het
Olfr972	G	T	9: 39,873,411	M45I	probably benign	Het
Pex5l	T	C	3: 33,014,980	T123A	probably damaging	Het
Pip5kl1	A	T	2: 32,576,679	N62I	probably benign	Het
Pkhd1l1	T	C	15: 44,545,494	V2459A	probably damaging	Het
Prb1	T	A	6: 132,207,476	Q398L	unknown	Het
Prkab2	T	C	3: 97,663,947	L165S	probably damaging	Het
Prl3d2	C	G	13: 27,121,706		probably benign	Het
Ptdss1	G	A	13: 66,995,408	G435D	probably benign	Het
Qrfpr	A	G	3: 36,182,580	L224P	probably damaging	Het
Rasl2-9	C	T	7: 5,125,442	W163*	probably null	Het
Rgs5	A	G	1: 169,690,414		probably null	Het
Rnf19b	T	C	4: 129,078,961	L255P	probably damaging	Het
Rp9	A	C	9: 22,457,455	N69K	probably damaging	Het
Sh3bp4	G	T	1: 89,145,488	S686I	probably damaging	Het
Spp2	C	A	1: 88,412,293	Q5K	possibly damaging	Het
Svep1	C	T	4: 58,070,239	G2516R	probably damaging	Het
Syncrip	A	C	9: 88,479,896	S55R	probably damaging	Het
Tacc3	T	C	5: 33,661,308	L29P	probably damaging	Het
Tex15	A	G	8: 33,575,092	T1517A	probably damaging	Het
Tmem140	A	G	6: 34,872,725	M59V	probably benign	Het
Ttn	G	T	2: 76,745,528	A25007E	probably damaging	Het
Ubr2	T	C	17: 46,986,689	T253A	possibly damaging	Het
Unc80	C	T	1: 66,521,581	H823Y	possibly damaging	Het
Usp38	A	G	8: 80,995,770	L374P	probably damaging	Het
Vmn1r42	T	A	6: 89,845,501	I29L	probably benign	Het
Vmn2r94	C	T	17: 18,256,980	V390M	probably benign	Het
Vmp1	A	G	11: 86,661,200	Y113H	possibly damaging	Het
Wdr20	T	C	12: 110,794,030	M450T	probably benign	Het
Ylpm1	T	C	12: 85,014,996	V557A	unknown	Het
Zpld1	T	C	16: 55,233,572	N286D	probably damaging	Het

Other mutations in Aff4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00793:Aff4	APN	11	53411990	missense	probably damaging	0.98
IGL01348:Aff4	APN	11	53402500	missense	probably benign
IGL01446:Aff4	APN	11	53415469	missense	probably damaging	0.99
IGL02151:Aff4	APN	11	53399806	missense	probably benign
IGL02526:Aff4	APN	11	53406682	splice site	probably benign
IGL02567:Aff4	APN	11	53372751	missense	possibly damaging	0.64
IGL02633:Aff4	APN	11	53409371	splice site	probably benign
IGL02707:Aff4	APN	11	53399740	missense	probably benign
R0090:Aff4	UTSW	11	53392782	missense	probably benign	0.01
R0128:Aff4	UTSW	11	53415466	missense	probably damaging	0.99
R0243:Aff4	UTSW	11	53397858	missense	possibly damaging	0.74
R0345:Aff4	UTSW	11	53372881	missense	probably benign	0.00
R0347:Aff4	UTSW	11	53400088	missense	probably benign	0.01
R0732:Aff4	UTSW	11	53375596	missense	probably benign
R0737:Aff4	UTSW	11	53410953	nonsense	probably null
R1464:Aff4	UTSW	11	53372524	missense	probably damaging	0.97
R1464:Aff4	UTSW	11	53372524	missense	probably damaging	0.97
R1693:Aff4	UTSW	11	53396553	missense	probably damaging	1.00
R1743:Aff4	UTSW	11	53368695	missense	possibly damaging	0.65
R1961:Aff4	UTSW	11	53372999	missense	probably damaging	1.00
R2048:Aff4	UTSW	11	53398385	missense	probably benign	0.39
R2138:Aff4	UTSW	11	53372512	missense	possibly damaging	0.94
R2155:Aff4	UTSW	11	53399619	missense	probably damaging	1.00
R2379:Aff4	UTSW	11	53408478	splice site	probably benign
R4156:Aff4	UTSW	11	53410899	intron	probably benign
R5001:Aff4	UTSW	11	53404357	missense	probably damaging	1.00
R5281:Aff4	UTSW	11	53372288	missense	probably damaging	1.00
R5477:Aff4	UTSW	11	53408472	critical splice donor site	probably null
R5677:Aff4	UTSW	11	53400275	missense	possibly damaging	0.55
R5992:Aff4	UTSW	11	53373010	missense	probably damaging	0.99
R6576:Aff4	UTSW	11	53400441	missense	probably damaging	1.00
R6764:Aff4	UTSW	11	53399830	missense	probably damaging	1.00
R6988:Aff4	UTSW	11	53398237	missense	probably damaging	1.00
R7034:Aff4	UTSW	11	53408409	missense	probably damaging	0.99
R7177:Aff4	UTSW	11	53406639	missense	probably benign	0.10
R7426:Aff4	UTSW	11	53372875	missense	probably damaging	1.00
R7755:Aff4	UTSW	11	53398379	missense	probably damaging	0.97
R7848:Aff4	UTSW	11	53404512	missense	probably benign	0.05
R7968:Aff4	UTSW	11	53409348	missense	probably damaging	1.00
R8159:Aff4	UTSW	11	53411894	missense	possibly damaging	0.71
R8218:Aff4	UTSW	11	53398257	missense	probably damaging	0.98
R8241:Aff4	UTSW	11	53400171	missense	probably benign	0.00
R8284:Aff4	UTSW	11	53404552	missense	probably damaging	0.99
R8373:Aff4	UTSW	11	53400267	nonsense	probably null
R8695:Aff4	UTSW	11	53368682	missense	not run
R8777:Aff4	UTSW	11	53399956	missense	probably damaging	1.00
R8777-TAIL:Aff4	UTSW	11	53399956	missense	probably damaging	1.00
R8780:Aff4	UTSW	11	53380617	missense	not run
R8798:Aff4	UTSW	11	53400508	critical splice donor site	unknown

Predicted Primers

PCR Primer
(F):5'- AGTGCTCACCCAGCGTGTAAAC -3'
(R):5'- TCCTGCTACTGCTGTAGGAGTCAC -3'

Sequencing Primer
(F):5'- CCCAGCGTGTAAACGGTTC -3'
(R):5'- CTGTAGGAGTCACGGTCATGC -3'

Posted On

2014-04-13