Mutagenetix > Incidental Mutations

Incidental Mutation 'R1500:Gldc'

169228

Institutional Source

Beutler Lab

Gene Symbol

Gldc

Ensembl Gene

ENSMUSG00000024827

Gene Name

glycine decarboxylase

Synonyms

D030049L12Rik, D19Wsu57e

MMRRC Submission

039551-MU

Accession Numbers

Genbank: NM_138595.1

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1500 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30098449-30175418 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 30113825 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 790 (V790G)

Ref Sequence

ENSEMBL: ENSMUSP00000025778 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025778]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025778
AA Change: V790G

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: V790G

Domain	Start	End	E-Value	Type
low complexity region	5	28	N/A	INTRINSIC
low complexity region	33	56	N/A	INTRINSIC
Pfam:GDC-P	70	493	1.1e-202	PFAM
low complexity region	504	515	N/A	INTRINSIC
Pfam:GDC-P	519	798	6.5e-8	PFAM
Pfam:Beta_elim_lyase	589	745	2e-10	PFAM

Meta Mutation Damage Score

0.9093

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.7%
20x: 87.1%

Validation Efficiency

95% (81/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	C	A	11: 78,284,132	Q1698K	possibly damaging	Het
A230050P20Rik	AGAGGAGGAGGAGGAGGAGGAGGAGGA	AGAGGAGGAGGAGGAGGAGGAGGA	9: 20,873,717		probably benign	Het
Abcg1	A	G	17: 31,111,279	D518G	probably benign	Het
Acaca	T	A	11: 84,293,984	D96E	probably benign	Het
Actbl2	G	A	13: 111,255,320	R63Q	probably damaging	Het
Adamts6	T	A	13: 104,312,881	H266Q	probably damaging	Het
Aff4	T	C	11: 53,372,378	V75A	probably benign	Het
Ank2	A	G	3: 126,932,982	S888P	probably benign	Het
Ano7	T	C	1: 93,397,328	F534S	probably damaging	Het
Arhgef6	T	C	X: 57,338,562	M5V	probably benign	Het
Bcam	T	A	7: 19,758,964	D484V	possibly damaging	Het
Ccdc88a	T	C	11: 29,482,713	Y1240H	probably benign	Het
Cfh	T	C	1: 140,100,876	Y500C	probably damaging	Het
Chd1l	G	A	3: 97,582,805	A478V	probably benign	Het
Dnah1	T	C	14: 31,316,758	D122G	probably benign	Het
Dnah11	A	T	12: 118,012,829		probably null	Het
Dnah17	T	C	11: 118,101,053	K1230E	probably benign	Het
Dync1h1	G	A	12: 110,636,509	E2195K	probably benign	Het
E330020D12Rik	A	T	1: 153,408,379		noncoding transcript	Het
Ece2	T	C	16: 20,644,242	L639P	probably damaging	Het
Epha3	A	T	16: 63,595,662	V658E	probably benign	Het
Erbb2	C	T	11: 98,428,978	T632I	probably damaging	Het
Erc2	A	G	14: 28,271,660	T883A	probably damaging	Het
Extl2	T	C	3: 116,027,140	V198A	probably benign	Het
Fktn	G	T	4: 53,735,065	M234I	probably benign	Het
Ggt7	A	G	2: 155,499,046	S400P	probably benign	Het
Gm14496	A	C	2: 181,991,233	Q3P	probably benign	Het
H2-D1	G	A	17: 35,263,588	E95K	probably benign	Het
Ikzf3	T	C	11: 98,518,695	E14G	probably benign	Het
Jag1	A	T	2: 137,115,638	N51K	possibly damaging	Het
Khdrbs3	A	G	15: 68,928,786	D14G	possibly damaging	Het
Krt84	A	G	15: 101,530,224	V276A	probably damaging	Het
Lamb1	T	C	12: 31,298,949	I660T	possibly damaging	Het
Lcmt2	A	T	2: 121,140,007	S198R	probably benign	Het
Lcn6	G	A	2: 25,677,119	R44H	probably benign	Het
Lrfn5	A	T	12: 61,839,741	H105L	probably damaging	Het
Lrit1	G	A	14: 37,062,134	R473K	probably benign	Het
March1	A	G	8: 66,468,390	T495A	probably damaging	Het
Marveld3	T	G	8: 109,948,542		probably null	Het
Mbd3	T	C	10: 80,394,586	D160G	possibly damaging	Het
Mrc2	T	G	11: 105,347,725	C1233G	probably damaging	Het
Ms4a13	T	G	19: 11,183,861	T105P	probably damaging	Het
Mtbp	T	C	15: 55,617,555	Y306H	probably damaging	Het
Muc3a	T	C	5: 137,210,501		probably benign	Het
Myo1g	T	A	11: 6,520,811	Y15F	probably benign	Het
Nae1	A	T	8: 104,523,584	Y226N	probably benign	Het
Nlrp9a	A	G	7: 26,567,891	S715G	probably benign	Het
Olfr1193	T	A	2: 88,677,875	S7T	possibly damaging	Het
Olfr338	A	T	2: 36,377,621	M282L	probably benign	Het
Olfr699	T	C	7: 106,790,821	Y60C	probably damaging	Het
Olfr844	A	T	9: 19,319,316	S267C	probably damaging	Het
Olfr972	G	T	9: 39,873,411	M45I	probably benign	Het
Pex5l	T	C	3: 33,014,980	T123A	probably damaging	Het
Pip5kl1	A	T	2: 32,576,679	N62I	probably benign	Het
Pkhd1l1	T	C	15: 44,545,494	V2459A	probably damaging	Het
Prb1	T	A	6: 132,207,476	Q398L	unknown	Het
Prkab2	T	C	3: 97,663,947	L165S	probably damaging	Het
Prl3d2	C	G	13: 27,121,706		probably benign	Het
Ptdss1	G	A	13: 66,995,408	G435D	probably benign	Het
Qrfpr	A	G	3: 36,182,580	L224P	probably damaging	Het
Rasl2-9	C	T	7: 5,125,442	W163*	probably null	Het
Rgs5	A	G	1: 169,690,414		probably null	Het
Rnf19b	T	C	4: 129,078,961	L255P	probably damaging	Het
Rp9	A	C	9: 22,457,455	N69K	probably damaging	Het
Sh3bp4	G	T	1: 89,145,488	S686I	probably damaging	Het
Spp2	C	A	1: 88,412,293	Q5K	possibly damaging	Het
Svep1	C	T	4: 58,070,239	G2516R	probably damaging	Het
Syncrip	A	C	9: 88,479,896	S55R	probably damaging	Het
Tacc3	T	C	5: 33,661,308	L29P	probably damaging	Het
Tex15	A	G	8: 33,575,092	T1517A	probably damaging	Het
Tmem140	A	G	6: 34,872,725	M59V	probably benign	Het
Ttn	G	T	2: 76,745,528	A25007E	probably damaging	Het
Ubr2	T	C	17: 46,986,689	T253A	possibly damaging	Het
Unc80	C	T	1: 66,521,581	H823Y	possibly damaging	Het
Usp38	A	G	8: 80,995,770	L374P	probably damaging	Het
Vmn1r42	T	A	6: 89,845,501	I29L	probably benign	Het
Vmn2r94	C	T	17: 18,256,980	V390M	probably benign	Het
Vmp1	A	G	11: 86,661,200	Y113H	possibly damaging	Het
Wdr20	T	C	12: 110,794,030	M450T	probably benign	Het
Ylpm1	T	C	12: 85,014,996	V557A	unknown	Het
Zpld1	T	C	16: 55,233,572	N286D	probably damaging	Het

Other mutations in Gldc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Gldc	APN	19	30115240	missense	probably damaging	1.00
IGL01016:Gldc	APN	19	30133493	missense	possibly damaging	0.93
IGL01112:Gldc	APN	19	30158513	critical splice donor site	probably null
IGL01510:Gldc	APN	19	30113721	critical splice donor site	probably null
IGL01516:Gldc	APN	19	30099032	missense	probably damaging	1.00
IGL01598:Gldc	APN	19	30133756	missense	probably damaging	1.00
IGL01646:Gldc	APN	19	30100765	missense	possibly damaging	0.61
IGL02024:Gldc	APN	19	30100827	missense	probably damaging	1.00
IGL02125:Gldc	APN	19	30147241	missense	probably benign	0.03
IGL02548:Gldc	APN	19	30099899	missense	probably benign
IGL02711:Gldc	APN	19	30145146	critical splice donor site	probably null
IGL02818:Gldc	APN	19	30136509	missense	probably damaging	0.99
IGL02982:Gldc	APN	19	30145145	critical splice donor site	probably null
IGL03165:Gldc	APN	19	30098993	missense	possibly damaging	0.61
jojoba	UTSW	19	30133512	missense	probably damaging	1.00
miserable	UTSW	19	30151536	missense	probably damaging	1.00
Urchin	UTSW	19	30118602	missense	probably damaging	0.98
I2289:Gldc	UTSW	19	30147176	nonsense	probably null
R0180:Gldc	UTSW	19	30100817	missense	possibly damaging	0.95
R0269:Gldc	UTSW	19	30118602	missense	probably damaging	0.98
R0277:Gldc	UTSW	19	30116451	missense	possibly damaging	0.84
R1085:Gldc	UTSW	19	30151428	missense	probably damaging	1.00
R1159:Gldc	UTSW	19	30160762	intron	probably benign
R1507:Gldc	UTSW	19	30118638	missense	probably damaging	1.00
R1592:Gldc	UTSW	19	30160677	intron	probably benign
R1593:Gldc	UTSW	19	30113750	missense	probably damaging	1.00
R1675:Gldc	UTSW	19	30143453	missense	probably damaging	1.00
R1869:Gldc	UTSW	19	30139332	missense	probably benign
R1965:Gldc	UTSW	19	30137113	nonsense	probably null
R2312:Gldc	UTSW	19	30100826	missense	probably damaging	0.98
R2425:Gldc	UTSW	19	30131790	missense	probably damaging	1.00
R3836:Gldc	UTSW	19	30118675	splice site	probably benign
R3837:Gldc	UTSW	19	30118675	splice site	probably benign
R3839:Gldc	UTSW	19	30118675	splice site	probably benign
R4191:Gldc	UTSW	19	30145658	missense	probably damaging	0.96
R4380:Gldc	UTSW	19	30160768	intron	probably benign
R4508:Gldc	UTSW	19	30143407	missense	probably damaging	1.00
R4570:Gldc	UTSW	19	30174439	missense	probably benign
R4655:Gldc	UTSW	19	30160702	intron	probably benign
R4842:Gldc	UTSW	19	30133732	missense	possibly damaging	0.94
R5070:Gldc	UTSW	19	30118598	missense	possibly damaging	0.84
R5085:Gldc	UTSW	19	30151536	missense	probably damaging	1.00
R5268:Gldc	UTSW	19	30145725	missense	probably damaging	0.96
R5368:Gldc	UTSW	19	30158521	missense	probably benign
R5718:Gldc	UTSW	19	30110772	nonsense	probably null
R5878:Gldc	UTSW	19	30143467	splice site	probably null
R6192:Gldc	UTSW	19	30133772	missense	probably damaging	0.98
R6453:Gldc	UTSW	19	30116517	missense	probably damaging	0.99
R6777:Gldc	UTSW	19	30133512	missense	probably damaging	1.00
R6865:Gldc	UTSW	19	30133762	missense	possibly damaging	0.92
R7332:Gldc	UTSW	19	30116526	missense	probably damaging	0.99
R7390:Gldc	UTSW	19	30099914	missense	possibly damaging	0.46
R7647:Gldc	UTSW	19	30118667	missense	probably damaging	0.96
R8081:Gldc	UTSW	19	30158587	frame shift	probably null
R8171:Gldc	UTSW	19	30133761	missense	probably benign	0.24
R8321:Gldc	UTSW	19	30143407	nonsense	probably null
R8374:Gldc	UTSW	19	30137194	missense	probably damaging	1.00
R8503:Gldc	UTSW	19	30099854	missense	probably benign	0.26
R8510:Gldc	UTSW	19	30116505	missense	probably damaging	1.00
R8785:Gldc	UTSW	19	30115234	missense	probably damaging	1.00
R8818:Gldc	UTSW	19	30100812	missense	probably benign	0.05
R8820:Gldc	UTSW	19	30100812	missense	probably benign	0.05
R8829:Gldc	UTSW	19	30100812	missense	probably benign	0.05
R8830:Gldc	UTSW	19	30100812	missense	probably benign	0.05
R8859:Gldc	UTSW	19	30139379	missense	probably damaging	1.00
R8887:Gldc	UTSW	19	30133756	missense	possibly damaging	0.94
R8935:Gldc	UTSW	19	30131693	missense	probably benign	0.00
R8940:Gldc	UTSW	19	30151484	missense	probably benign
Z1177:Gldc	UTSW	19	30110778	missense	probably damaging	1.00
Z1177:Gldc	UTSW	19	30110779	missense	probably damaging	0.99
Z1177:Gldc	UTSW	19	30145748	missense	possibly damaging	0.61

Predicted Primers

PCR Primer
(F):5'- AGCTGTGTGTACCCAACAGGAAAC -3'
(R):5'- AGTGTCATGTCCCTACCACCATGAG -3'

Sequencing Primer
(F):5'- agatgaaacagttctgggtgg -3'
(R):5'- AGTTGCGTCTTTTCCGCA -3'

Posted On

2014-04-13