Mutagenetix > Incidental Mutation

Incidental Mutation 'R1501:Pikfyve'

169230

Institutional Source

Beutler Lab

Gene Symbol

Pikfyve

Ensembl Gene

ENSMUSG00000025949

Gene Name

phosphoinositide kinase, FYVE type zinc finger containing

Synonyms

PipkIII, Pip5k3, 5230400C17Rik

MMRRC Submission

040867-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1501 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

65225842-65317854 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 65304443 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1670 (I1670N)

Ref Sequence

ENSEMBL: ENSMUSP00000079926 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707]

AlphaFold

Q9Z1T6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000081154
AA Change: I1670N

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: I1670N

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	161	230	5.95e-18	SMART
DEP	376	451	9.05e-27	SMART
Pfam:Cpn60_TCP1	547	822	2e-37	PFAM
low complexity region	1177	1189	N/A	INTRINSIC
low complexity region	1516	1536	N/A	INTRINSIC
PIPKc	1745	2039	3.03e-162	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000097707
AA Change: I1715N

PolyPhen 2 Score 0.560 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: I1715N

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	150	219	5.95e-18	SMART
DEP	365	440	9.05e-27	SMART
Pfam:Cpn60_TCP1	590	864	1.8e-35	PFAM
low complexity region	1222	1234	N/A	INTRINSIC
low complexity region	1561	1581	N/A	INTRINSIC
PIPKc	1790	2084	3.03e-162	SMART

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap11	A	T	14: 78,750,787 (GRCm39)	S533R	probably benign	Het
Amph	C	T	13: 19,288,461 (GRCm39)	Q317*	probably null	Het
Bach2	A	G	4: 32,562,279 (GRCm39)	T249A	possibly damaging	Het
Cacna2d3	A	G	14: 28,703,137 (GRCm39)	C845R	probably damaging	Het
Calml4	A	G	9: 62,778,622 (GRCm39)	K12E	probably benign	Het
Chrd	C	T	16: 20,556,283 (GRCm39)	R615W	probably damaging	Het
Chst15	T	A	7: 131,870,798 (GRCm39)	K246*	probably null	Het
Cmtr2	G	A	8: 110,948,235 (GRCm39)	D182N	probably benign	Het
Cyp2d9	C	A	15: 82,338,525 (GRCm39)	C186*	probably null	Het
Cyp3a13	G	T	5: 137,909,892 (GRCm39)		probably null	Het
Dcaf17	A	T	2: 70,912,332 (GRCm39)	I320F	probably damaging	Het
Ddx10	T	C	9: 53,145,297 (GRCm39)	I227V	possibly damaging	Het
Dlc1	G	T	8: 37,405,302 (GRCm39)	N162K	probably benign	Het
Dnhd1	G	A	7: 105,317,670 (GRCm39)	R455H	probably benign	Het
Drg2	G	T	11: 60,355,679 (GRCm39)	A306S	probably benign	Het
Dsg1a	A	T	18: 20,465,076 (GRCm39)	R422S	probably damaging	Het
Ehbp1l1	A	G	19: 5,766,452 (GRCm39)	V353A	probably damaging	Het
Emilin2	T	C	17: 71,617,756 (GRCm39)	S34G	probably benign	Het
Enpp2	C	A	15: 54,702,910 (GRCm39)	W862L	probably damaging	Het
Exoc2	T	C	13: 31,119,485 (GRCm39)	I139V	probably benign	Het
Fhad1	C	T	4: 141,691,936 (GRCm39)	R400H	probably benign	Het
Fv1	C	T	4: 147,954,595 (GRCm39)	T387M	probably damaging	Het
Gatad1	T	A	5: 3,693,701 (GRCm39)	D156V	probably damaging	Het
Gm4744	A	G	6: 40,927,367 (GRCm39)		probably benign	Het
Gm4799	G	A	10: 82,790,469 (GRCm39)		noncoding transcript	Het
Hadha	A	G	5: 30,333,804 (GRCm39)	F405S	probably benign	Het
Ifit3	T	C	19: 34,565,651 (GRCm39)	V399A	probably benign	Het
Il1rapl1	G	T	X: 86,348,469 (GRCm39)	Y150*	probably null	Het
Kirrel1	T	C	3: 86,997,779 (GRCm39)	E248G	probably benign	Het
Krt72	C	A	15: 101,686,769 (GRCm39)	K392N	probably damaging	Het
Loxhd1	G	A	18: 77,444,528 (GRCm39)	G309D	probably damaging	Het
Mc3r	T	G	2: 172,091,300 (GRCm39)	I174S	probably benign	Het
Me3	A	G	7: 89,282,273 (GRCm39)	D52G	probably benign	Het
Med12l	T	C	3: 59,168,256 (GRCm39)		probably null	Het
Mgat5	G	A	1: 127,325,378 (GRCm39)		probably null	Het
Mphosph10	A	T	7: 64,039,252 (GRCm39)	F239L	probably damaging	Het
Mrps7	T	C	11: 115,495,023 (GRCm39)	S13P	probably benign	Het
Nexn	T	C	3: 151,943,323 (GRCm39)	T527A	possibly damaging	Het
Nlrp1b	G	A	11: 71,046,885 (GRCm39)	H1156Y	probably damaging	Het
Nostrin	A	G	2: 68,989,129 (GRCm39)	E120G	probably damaging	Het
Nsun2	A	G	13: 69,779,706 (GRCm39)	E624G	probably damaging	Het
Oga	T	C	19: 45,767,079 (GRCm39)	D99G	probably null	Het
Or4c102	G	A	2: 88,422,492 (GRCm39)	V115I	possibly damaging	Het
Or4k2	A	G	14: 50,424,539 (GRCm39)	I45T	probably damaging	Het
Or52n4b	G	A	7: 108,143,782 (GRCm39)	V15I	probably benign	Het
Or5p70	A	C	7: 107,995,289 (GRCm39)	K321Q	probably benign	Het
Phldb2	T	C	16: 45,598,146 (GRCm39)	N802S	probably damaging	Het
Pik3c2g	T	C	6: 139,789,796 (GRCm39)		probably null	Het
Pld5	A	G	1: 175,803,087 (GRCm39)	F393L	probably benign	Het
Plekhg1	C	A	10: 3,907,361 (GRCm39)	D759E	probably benign	Het
Plekhm1	A	G	11: 103,277,888 (GRCm39)	S403P	probably benign	Het
Pop1	T	C	15: 34,510,503 (GRCm39)	F432L	probably benign	Het
Ptpn13	T	C	5: 103,664,230 (GRCm39)	I406T	probably benign	Het
Ptpn5	G	T	7: 46,739,623 (GRCm39)	D185E	probably benign	Het
Rad50	G	T	11: 53,578,978 (GRCm39)	Q527K	possibly damaging	Het
Scn7a	A	G	2: 66,530,507 (GRCm39)	F613L	probably benign	Het
Sec16a	T	A	2: 26,330,057 (GRCm39)	M653L	probably benign	Het
Sh3bp2	T	C	5: 34,712,920 (GRCm39)		probably null	Het
Slc22a3	G	A	17: 12,725,991 (GRCm39)	T74I	probably benign	Het
Slc23a4	A	G	6: 34,932,057 (GRCm39)	L272P	probably damaging	Het
Slc26a8	T	C	17: 28,857,536 (GRCm39)	D869G	possibly damaging	Het
Slc5a11	T	A	7: 122,859,731 (GRCm39)	V291E	probably damaging	Het
Slc6a19	C	A	13: 73,832,167 (GRCm39)	A470S	probably benign	Het
Slfn8	A	G	11: 82,894,006 (GRCm39)	S878P	probably damaging	Het
Smchd1	A	G	17: 71,672,089 (GRCm39)	M1655T	possibly damaging	Het
Srgap2	A	G	1: 131,220,437 (GRCm39)	L179P	probably damaging	Het
Tbx2	A	G	11: 85,725,622 (GRCm39)	D191G	probably damaging	Het
Tenm3	A	G	8: 48,796,351 (GRCm39)	Y485H	probably damaging	Het
Trim12c	T	A	7: 103,990,095 (GRCm39)		probably benign	Het
Trpc6	A	G	9: 8,610,170 (GRCm39)	T213A	probably damaging	Het
Upp1	T	A	11: 9,084,708 (GRCm39)		probably null	Het
Vmn1r46	A	T	6: 89,953,198 (GRCm39)	I16L	probably benign	Het
Vmn2r75	A	T	7: 85,814,850 (GRCm39)	D214E	possibly damaging	Het
Vmn2r95	T	A	17: 18,660,118 (GRCm39)	Y177N	probably damaging	Het
Vmn2r99	T	G	17: 19,582,521 (GRCm39)	I42S	possibly damaging	Het
Zeb1	A	T	18: 5,761,399 (GRCm39)	K232N	possibly damaging	Het
Zfp280b	T	C	10: 75,875,603 (GRCm39)	I494T	probably damaging	Het
Zfp804a	A	G	2: 82,066,143 (GRCm39)	D38G	probably damaging	Het

Other mutations in Pikfyve

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Pikfyve	APN	1	65,299,280 (GRCm39)	critical splice donor site	probably null
IGL01135:Pikfyve	APN	1	65,290,794 (GRCm39)	missense	probably damaging	0.96
IGL01511:Pikfyve	APN	1	65,298,028 (GRCm39)	nonsense	probably null
IGL01759:Pikfyve	APN	1	65,292,512 (GRCm39)	missense	probably benign	0.06
IGL01888:Pikfyve	APN	1	65,262,799 (GRCm39)	missense	probably damaging	1.00
IGL01967:Pikfyve	APN	1	65,303,524 (GRCm39)	missense	possibly damaging	0.89
IGL02055:Pikfyve	APN	1	65,277,703 (GRCm39)	critical splice donor site	probably null
IGL02119:Pikfyve	APN	1	65,311,730 (GRCm39)	missense	probably damaging	1.00
IGL02141:Pikfyve	APN	1	65,285,556 (GRCm39)	missense	probably benign	0.13
IGL02207:Pikfyve	APN	1	65,290,837 (GRCm39)	critical splice donor site	probably null
IGL02380:Pikfyve	APN	1	65,295,180 (GRCm39)	missense	probably damaging	0.99
IGL02400:Pikfyve	APN	1	65,291,728 (GRCm39)	missense	probably damaging	1.00
IGL02403:Pikfyve	APN	1	65,283,663 (GRCm39)	missense	probably damaging	0.99
IGL02426:Pikfyve	APN	1	65,290,771 (GRCm39)	missense	possibly damaging	0.77
IGL02496:Pikfyve	APN	1	65,303,535 (GRCm39)	missense	possibly damaging	0.94
IGL02573:Pikfyve	APN	1	65,270,014 (GRCm39)	critical splice donor site	probably null
IGL02746:Pikfyve	APN	1	65,273,431 (GRCm39)	missense	probably damaging	1.00
IGL02814:Pikfyve	APN	1	65,289,353 (GRCm39)	nonsense	probably null
IGL02890:Pikfyve	APN	1	65,269,956 (GRCm39)	missense	probably benign	0.00
IGL03102:Pikfyve	APN	1	65,291,626 (GRCm39)	nonsense	probably null
IGL03294:Pikfyve	APN	1	65,286,226 (GRCm39)	missense	probably damaging	1.00
falcon	UTSW	1	65,235,900 (GRCm39)	missense	probably damaging	1.00
oompa	UTSW	1	65,235,865 (GRCm39)	missense	probably damaging	1.00
wonka	UTSW	1	65,235,865 (GRCm39)	missense	probably damaging	1.00
G5538:Pikfyve	UTSW	1	65,242,075 (GRCm39)	missense	probably damaging	1.00
R0031:Pikfyve	UTSW	1	65,255,088 (GRCm39)	splice site	probably benign
R0196:Pikfyve	UTSW	1	65,295,231 (GRCm39)	missense	possibly damaging	0.92
R0212:Pikfyve	UTSW	1	65,302,064 (GRCm39)	missense	probably benign	0.41
R0319:Pikfyve	UTSW	1	65,285,490 (GRCm39)	missense	probably benign	0.01
R0332:Pikfyve	UTSW	1	65,303,558 (GRCm39)	missense	probably benign	0.02
R0389:Pikfyve	UTSW	1	65,235,865 (GRCm39)	missense	probably damaging	1.00
R0443:Pikfyve	UTSW	1	65,235,865 (GRCm39)	missense	probably damaging	1.00
R0503:Pikfyve	UTSW	1	65,259,058 (GRCm39)	missense	probably damaging	0.97
R0722:Pikfyve	UTSW	1	65,292,682 (GRCm39)	missense	probably damaging	0.99
R0906:Pikfyve	UTSW	1	65,292,556 (GRCm39)	missense	probably damaging	1.00
R0907:Pikfyve	UTSW	1	65,241,989 (GRCm39)	missense	possibly damaging	0.64
R0970:Pikfyve	UTSW	1	65,304,983 (GRCm39)	missense	probably damaging	0.99
R1188:Pikfyve	UTSW	1	65,286,118 (GRCm39)	missense	possibly damaging	0.46
R1412:Pikfyve	UTSW	1	65,241,989 (GRCm39)	missense	possibly damaging	0.64
R1421:Pikfyve	UTSW	1	65,310,470 (GRCm39)	missense	probably damaging	1.00
R1468:Pikfyve	UTSW	1	65,290,825 (GRCm39)	missense	probably damaging	0.98
R1468:Pikfyve	UTSW	1	65,290,825 (GRCm39)	missense	probably damaging	0.98
R1472:Pikfyve	UTSW	1	65,263,360 (GRCm39)	missense	probably damaging	0.96
R1478:Pikfyve	UTSW	1	65,302,136 (GRCm39)	critical splice donor site	probably null
R1757:Pikfyve	UTSW	1	65,291,707 (GRCm39)	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65,285,529 (GRCm39)	missense	probably benign
R1773:Pikfyve	UTSW	1	65,231,430 (GRCm39)	missense	probably damaging	0.99
R1795:Pikfyve	UTSW	1	65,291,716 (GRCm39)	missense	probably damaging	1.00
R1855:Pikfyve	UTSW	1	65,297,957 (GRCm39)	missense	probably benign	0.03
R1905:Pikfyve	UTSW	1	65,231,454 (GRCm39)	critical splice donor site	probably null
R1995:Pikfyve	UTSW	1	65,285,867 (GRCm39)	missense	probably damaging	1.00
R2034:Pikfyve	UTSW	1	65,261,516 (GRCm39)	missense	probably damaging	1.00
R2045:Pikfyve	UTSW	1	65,292,512 (GRCm39)	missense	probably benign	0.06
R2229:Pikfyve	UTSW	1	65,307,014 (GRCm39)	missense	probably damaging	1.00
R2295:Pikfyve	UTSW	1	65,285,835 (GRCm39)	missense	probably damaging	0.99
R2913:Pikfyve	UTSW	1	65,292,676 (GRCm39)	missense	probably damaging	1.00
R3818:Pikfyve	UTSW	1	65,284,917 (GRCm39)	missense	probably damaging	1.00
R3832:Pikfyve	UTSW	1	65,283,579 (GRCm39)	missense	probably damaging	0.99
R3850:Pikfyve	UTSW	1	65,270,004 (GRCm39)	missense	probably damaging	1.00
R3946:Pikfyve	UTSW	1	65,235,840 (GRCm39)	missense	probably damaging	1.00
R4105:Pikfyve	UTSW	1	65,229,679 (GRCm39)	unclassified	probably benign
R4542:Pikfyve	UTSW	1	65,283,589 (GRCm39)	missense	probably damaging	1.00
R4574:Pikfyve	UTSW	1	65,231,351 (GRCm39)	missense	probably damaging	1.00
R4601:Pikfyve	UTSW	1	65,273,421 (GRCm39)	missense	probably damaging	1.00
R4667:Pikfyve	UTSW	1	65,289,432 (GRCm39)	missense	probably damaging	1.00
R4668:Pikfyve	UTSW	1	65,289,432 (GRCm39)	missense	probably damaging	1.00
R4669:Pikfyve	UTSW	1	65,289,432 (GRCm39)	missense	probably damaging	1.00
R4707:Pikfyve	UTSW	1	65,307,005 (GRCm39)	missense	probably benign
R4716:Pikfyve	UTSW	1	65,285,635 (GRCm39)	missense	possibly damaging	0.84
R4758:Pikfyve	UTSW	1	65,311,674 (GRCm39)	missense	possibly damaging	0.84
R4784:Pikfyve	UTSW	1	65,307,005 (GRCm39)	missense	probably benign
R4785:Pikfyve	UTSW	1	65,307,005 (GRCm39)	missense	probably benign
R4805:Pikfyve	UTSW	1	65,307,959 (GRCm39)	missense	probably damaging	0.99
R4831:Pikfyve	UTSW	1	65,235,900 (GRCm39)	missense	probably damaging	1.00
R4837:Pikfyve	UTSW	1	65,285,749 (GRCm39)	missense	possibly damaging	0.92
R5064:Pikfyve	UTSW	1	65,292,566 (GRCm39)	missense	probably damaging	1.00
R5115:Pikfyve	UTSW	1	65,263,276 (GRCm39)	intron	probably benign
R5265:Pikfyve	UTSW	1	65,306,988 (GRCm39)	missense	possibly damaging	0.72
R5279:Pikfyve	UTSW	1	65,235,858 (GRCm39)	nonsense	probably null
R5384:Pikfyve	UTSW	1	65,283,568 (GRCm39)	missense	probably damaging	1.00
R5387:Pikfyve	UTSW	1	65,304,427 (GRCm39)	missense	possibly damaging	0.94
R5461:Pikfyve	UTSW	1	65,274,192 (GRCm39)	missense	probably damaging	1.00
R5467:Pikfyve	UTSW	1	65,291,654 (GRCm39)	missense	probably damaging	1.00
R5560:Pikfyve	UTSW	1	65,292,566 (GRCm39)	missense	probably damaging	1.00
R5575:Pikfyve	UTSW	1	65,312,889 (GRCm39)	missense	probably damaging	1.00
R5611:Pikfyve	UTSW	1	65,295,247 (GRCm39)	missense	probably damaging	0.96
R5663:Pikfyve	UTSW	1	65,255,187 (GRCm39)	missense	probably benign	0.09
R5891:Pikfyve	UTSW	1	65,241,896 (GRCm39)	missense	probably damaging	1.00
R5960:Pikfyve	UTSW	1	65,292,597 (GRCm39)	nonsense	probably null
R6026:Pikfyve	UTSW	1	65,311,856 (GRCm39)	missense	probably damaging	1.00
R6057:Pikfyve	UTSW	1	65,311,730 (GRCm39)	missense	probably damaging	1.00
R6101:Pikfyve	UTSW	1	65,303,504 (GRCm39)	critical splice acceptor site	probably null
R6105:Pikfyve	UTSW	1	65,303,504 (GRCm39)	critical splice acceptor site	probably null
R6161:Pikfyve	UTSW	1	65,255,202 (GRCm39)	missense	probably benign	0.36
R6287:Pikfyve	UTSW	1	65,292,691 (GRCm39)	critical splice donor site	probably null
R6290:Pikfyve	UTSW	1	65,242,084 (GRCm39)	critical splice donor site	probably null
R6296:Pikfyve	UTSW	1	65,302,112 (GRCm39)	missense	probably damaging	0.99
R6516:Pikfyve	UTSW	1	65,304,940 (GRCm39)	missense	probably benign	0.35
R6835:Pikfyve	UTSW	1	65,298,002 (GRCm39)	missense	probably damaging	0.98
R6994:Pikfyve	UTSW	1	65,291,689 (GRCm39)	missense	probably damaging	1.00
R6997:Pikfyve	UTSW	1	65,285,822 (GRCm39)	missense	probably damaging	1.00
R7038:Pikfyve	UTSW	1	65,273,520 (GRCm39)	missense	probably damaging	1.00
R7044:Pikfyve	UTSW	1	65,286,013 (GRCm39)	missense	probably benign	0.01
R7057:Pikfyve	UTSW	1	65,286,364 (GRCm39)	missense	probably benign	0.00
R7525:Pikfyve	UTSW	1	65,283,585 (GRCm39)	nonsense	probably null
R7558:Pikfyve	UTSW	1	65,311,782 (GRCm39)	missense	probably benign	0.01
R7625:Pikfyve	UTSW	1	65,307,036 (GRCm39)	missense	possibly damaging	0.86
R7807:Pikfyve	UTSW	1	65,309,101 (GRCm39)	missense	probably damaging	1.00
R7961:Pikfyve	UTSW	1	65,294,293 (GRCm39)	missense	probably damaging	1.00
R8009:Pikfyve	UTSW	1	65,294,293 (GRCm39)	missense	probably damaging	1.00
R8154:Pikfyve	UTSW	1	65,304,948 (GRCm39)	missense	probably damaging	1.00
R8192:Pikfyve	UTSW	1	65,285,554 (GRCm39)	missense	possibly damaging	0.93
R8275:Pikfyve	UTSW	1	65,292,501 (GRCm39)	splice site	probably benign
R8307:Pikfyve	UTSW	1	65,284,894 (GRCm39)	missense	possibly damaging	0.77
R8710:Pikfyve	UTSW	1	65,255,155 (GRCm39)	missense	possibly damaging	0.94
R8867:Pikfyve	UTSW	1	65,283,576 (GRCm39)	missense	probably damaging	1.00
R8936:Pikfyve	UTSW	1	65,310,427 (GRCm39)	missense	possibly damaging	0.84
R8940:Pikfyve	UTSW	1	65,286,129 (GRCm39)	missense	probably benign	0.00
R8995:Pikfyve	UTSW	1	65,244,746 (GRCm39)	critical splice acceptor site	probably null
R9092:Pikfyve	UTSW	1	65,283,559 (GRCm39)	missense	probably damaging	1.00
R9131:Pikfyve	UTSW	1	65,285,239 (GRCm39)	missense	probably damaging	1.00
R9151:Pikfyve	UTSW	1	65,235,898 (GRCm39)	missense	probably damaging	1.00
R9210:Pikfyve	UTSW	1	65,291,719 (GRCm39)	missense	probably damaging	1.00
R9212:Pikfyve	UTSW	1	65,291,719 (GRCm39)	missense	probably damaging	1.00
R9235:Pikfyve	UTSW	1	65,299,188 (GRCm39)	missense	probably benign	0.37
R9368:Pikfyve	UTSW	1	65,307,901 (GRCm39)	missense	probably damaging	1.00
R9489:Pikfyve	UTSW	1	65,303,561 (GRCm39)	missense	probably benign
R9605:Pikfyve	UTSW	1	65,303,561 (GRCm39)	missense	probably benign
R9686:Pikfyve	UTSW	1	65,291,615 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCGGGTGATGTAGGTAAGGAGTACAGT -3'
(R):5'- CCTCTTCTGGGAAGACAGATCAGGGC -3'

Sequencing Primer
(F):5'- GGTAAGGAGTACAGTATTTTAGGAGC -3'
(R):5'- ttgtcttctgctttccacattc -3'

Posted On

2014-04-13