Mutagenetix > Incidental Mutation

Incidental Mutation 'R1501:Sec16a'

169235

Institutional Source

Beutler Lab

Gene Symbol

Sec16a

Ensembl Gene

ENSMUSG00000026924

Gene Name

SEC16 homolog A, endoplasmic reticulum export factor

Synonyms

C230052J16Rik

MMRRC Submission

040867-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.964) question?

Stock #

R1501 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

26409431-26445216 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 26440045 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 653 (M653L)

Ref Sequence

ENSEMBL: ENSMUSP00000109716 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091252] [ENSMUST00000114082]

AlphaFold

E9QAT4

Predicted Effect

probably benign
Transcript: ENSMUST00000091252
AA Change: M653L

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000088796
Gene: ENSMUSG00000026924
AA Change: M653L

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
low complexity region	204	221	N/A	INTRINSIC
low complexity region	243	254	N/A	INTRINSIC
low complexity region	371	382	N/A	INTRINSIC
low complexity region	537	561	N/A	INTRINSIC
low complexity region	608	621	N/A	INTRINSIC
low complexity region	760	777	N/A	INTRINSIC
low complexity region	1096	1105	N/A	INTRINSIC
low complexity region	1134	1150	N/A	INTRINSIC
low complexity region	1185	1195	N/A	INTRINSIC
low complexity region	1370	1392	N/A	INTRINSIC
Pfam:Sec16	1463	1565	3.1e-24	PFAM
low complexity region	1600	1614	N/A	INTRINSIC
Pfam:Sec16_C	1635	1898	2.3e-39	PFAM
low complexity region	2109	2124	N/A	INTRINSIC
low complexity region	2165	2177	N/A	INTRINSIC
low complexity region	2187	2197	N/A	INTRINSIC
low complexity region	2227	2242	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114082
AA Change: M653L

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000109716
Gene: ENSMUSG00000026924
AA Change: M653L

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
low complexity region	204	221	N/A	INTRINSIC
low complexity region	243	254	N/A	INTRINSIC
low complexity region	371	382	N/A	INTRINSIC
low complexity region	537	561	N/A	INTRINSIC
low complexity region	608	621	N/A	INTRINSIC
low complexity region	760	777	N/A	INTRINSIC
low complexity region	1096	1105	N/A	INTRINSIC
low complexity region	1134	1150	N/A	INTRINSIC
low complexity region	1185	1195	N/A	INTRINSIC
low complexity region	1370	1392	N/A	INTRINSIC
Pfam:Sec16	1464	1564	2.6e-10	PFAM
low complexity region	1600	1614	N/A	INTRINSIC
Pfam:Sec16_C	1636	1887	6.8e-45	PFAM
low complexity region	2109	2124	N/A	INTRINSIC
low complexity region	2165	2177	N/A	INTRINSIC
low complexity region	2187	2197	N/A	INTRINSIC
low complexity region	2227	2242	N/A	INTRINSIC
low complexity region	2310	2320	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000153996

SMART Domains

Protein: ENSMUSP00000121179
Gene: ENSMUSG00000026924

Domain	Start	End	E-Value	Type
low complexity region	12	29	N/A	INTRINSIC
low complexity region	116	125	N/A	INTRINSIC
low complexity region	154	170	N/A	INTRINSIC
low complexity region	205	215	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155252

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that forms part of the Sec16 complex. This protein has a role in protein transport from the endoplasmic reticulum (ER) to the Golgi and mediates COPII vesicle formation at the transitional ER. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Feb 2013]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap11	A	T	14: 78,513,347	S533R	probably benign	Het
Amph	C	T	13: 19,104,291	Q317*	probably null	Het
Bach2	A	G	4: 32,562,279	T249A	possibly damaging	Het
Cacna2d3	A	G	14: 28,981,180	C845R	probably damaging	Het
Calml4	A	G	9: 62,871,340	K12E	probably benign	Het
Chrd	C	T	16: 20,737,533	R615W	probably damaging	Het
Chst15	T	A	7: 132,269,069	K246*	probably null	Het
Cmtr2	G	A	8: 110,221,603	D182N	probably benign	Het
Cyp2d9	C	A	15: 82,454,324	C186*	probably null	Het
Cyp3a13	G	T	5: 137,911,630		probably null	Het
Dcaf17	A	T	2: 71,081,988	I320F	probably damaging	Het
Ddx10	T	C	9: 53,233,997	I227V	possibly damaging	Het
Dlc1	G	T	8: 36,938,148	N162K	probably benign	Het
Dnhd1	G	A	7: 105,668,463	R455H	probably benign	Het
Drg2	G	T	11: 60,464,853	A306S	probably benign	Het
Dsg1a	A	T	18: 20,332,019	R422S	probably damaging	Het
Ehbp1l1	A	G	19: 5,716,424	V353A	probably damaging	Het
Emilin2	T	C	17: 71,310,761	S34G	probably benign	Het
Enpp2	C	A	15: 54,839,514	W862L	probably damaging	Het
Exoc2	T	C	13: 30,935,502	I139V	probably benign	Het
Fhad1	C	T	4: 141,964,625	R400H	probably benign	Het
Fv1	C	T	4: 147,870,138	T387M	probably damaging	Het
Gatad1	T	A	5: 3,643,701	D156V	probably damaging	Het
Gm4744	A	G	6: 40,950,433		probably benign	Het
Gm4799	G	A	10: 82,954,635		noncoding transcript	Het
Hadha	A	G	5: 30,128,806	F405S	probably benign	Het
Ifit3	T	C	19: 34,588,251	V399A	probably benign	Het
Il1rapl1	G	T	X: 87,304,863	Y150*	probably null	Het
Kirrel	T	C	3: 87,090,472	E248G	probably benign	Het
Krt72	C	A	15: 101,778,334	K392N	probably damaging	Het
Loxhd1	G	A	18: 77,356,832	G309D	probably damaging	Het
Mc3r	T	G	2: 172,249,380	I174S	probably benign	Het
Me3	A	G	7: 89,633,065	D52G	probably benign	Het
Med12l	T	C	3: 59,260,835		probably null	Het
Mgat5	G	A	1: 127,397,641		probably null	Het
Mgea5	T	C	19: 45,778,640	D99G	probably null	Het
Mphosph10	A	T	7: 64,389,504	F239L	probably damaging	Het
Mrps7	T	C	11: 115,604,197	S13P	probably benign	Het
Nexn	T	C	3: 152,237,686	T527A	possibly damaging	Het
Nlrp1b	G	A	11: 71,156,059	H1156Y	probably damaging	Het
Nostrin	A	G	2: 69,158,785	E120G	probably damaging	Het
Nsun2	A	G	13: 69,631,587	E624G	probably damaging	Het
Olfr1189	G	A	2: 88,592,148	V115I	possibly damaging	Het
Olfr495	A	C	7: 108,396,082	K321Q	probably benign	Het
Olfr503	G	A	7: 108,544,575	V15I	probably benign	Het
Olfr730	A	G	14: 50,187,082	I45T	probably damaging	Het
Phldb2	T	C	16: 45,777,783	N802S	probably damaging	Het
Pik3c2g	T	C	6: 139,844,070		probably null	Het
Pikfyve	T	A	1: 65,265,284	I1670N	possibly damaging	Het
Pld5	A	G	1: 175,975,521	F393L	probably benign	Het
Plekhg1	C	A	10: 3,957,361	D759E	probably benign	Het
Plekhm1	A	G	11: 103,387,062	S403P	probably benign	Het
Pop1	T	C	15: 34,510,357	F432L	probably benign	Het
Ptpn13	T	C	5: 103,516,364	I406T	probably benign	Het
Ptpn5	G	T	7: 47,089,875	D185E	probably benign	Het
Rad50	G	T	11: 53,688,151	Q527K	possibly damaging	Het
Scn7a	A	G	2: 66,700,163	F613L	probably benign	Het
Sh3bp2	T	C	5: 34,555,576		probably null	Het
Slc22a3	G	A	17: 12,507,104	T74I	probably benign	Het
Slc23a4	A	G	6: 34,955,122	L272P	probably damaging	Het
Slc26a8	T	C	17: 28,638,562	D869G	possibly damaging	Het
Slc5a11	T	A	7: 123,260,508	V291E	probably damaging	Het
Slc6a19	C	A	13: 73,684,048	A470S	probably benign	Het
Slfn8	A	G	11: 83,003,180	S878P	probably damaging	Het
Smchd1	A	G	17: 71,365,094	M1655T	possibly damaging	Het
Srgap2	A	G	1: 131,292,699	L179P	probably damaging	Het
Tbx2	A	G	11: 85,834,796	D191G	probably damaging	Het
Tenm3	A	G	8: 48,343,316	Y485H	probably damaging	Het
Trim12c	T	A	7: 104,340,888		probably benign	Het
Trpc6	A	G	9: 8,610,169	T213A	probably damaging	Het
Upp1	T	A	11: 9,134,708		probably null	Het
Vmn1r46	A	T	6: 89,976,216	I16L	probably benign	Het
Vmn2r75	A	T	7: 86,165,642	D214E	possibly damaging	Het
Vmn2r95	T	A	17: 18,439,856	Y177N	probably damaging	Het
Vmn2r99	T	G	17: 19,362,259	I42S	possibly damaging	Het
Zeb1	A	T	18: 5,761,399	K232N	possibly damaging	Het
Zfp280b	T	C	10: 76,039,769	I494T	probably damaging	Het
Zfp804a	A	G	2: 82,235,799	D38G	probably damaging	Het

Other mutations in Sec16a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Sec16a	APN	2	26439487	missense	probably benign	0.15
IGL00435:Sec16a	APN	2	26430101	missense	probably benign	0.00
IGL00469:Sec16a	APN	2	26428300	missense	probably damaging	1.00
IGL01622:Sec16a	APN	2	26438903	missense	probably benign	0.00
IGL01623:Sec16a	APN	2	26438903	missense	probably benign	0.00
IGL02158:Sec16a	APN	2	26416632	critical splice donor site	probably null
IGL02188:Sec16a	APN	2	26436008	missense	probably damaging	1.00
IGL02445:Sec16a	APN	2	26422040	missense	probably benign
IGL02568:Sec16a	APN	2	26436042	missense	probably damaging	1.00
IGL02710:Sec16a	APN	2	26430130	missense	possibly damaging	0.75
IGL02735:Sec16a	APN	2	26428137	splice site	probably benign
IGL02964:Sec16a	APN	2	26419723	missense	probably benign	0.00
IGL03027:Sec16a	APN	2	26423589	missense	probably benign	0.13
IGL03073:Sec16a	APN	2	26439183	missense	probably benign	0.02
IGL03297:Sec16a	APN	2	26439190	missense	probably benign	0.05
IGL03339:Sec16a	APN	2	26435933	missense	probably benign
H8562:Sec16a	UTSW	2	26441505	missense	probably benign
IGL03050:Sec16a	UTSW	2	26415747	missense	probably damaging	1.00
PIT4486001:Sec16a	UTSW	2	26425773	missense
R0039:Sec16a	UTSW	2	26423914	missense	probably benign	0.03
R0095:Sec16a	UTSW	2	26425760	splice site	probably null
R0095:Sec16a	UTSW	2	26425760	splice site	probably null
R0189:Sec16a	UTSW	2	26424414	splice site	probably null
R0255:Sec16a	UTSW	2	26431186	missense	probably damaging	0.97
R0278:Sec16a	UTSW	2	26428316	missense	probably damaging	1.00
R0739:Sec16a	UTSW	2	26441051	missense	possibly damaging	0.94
R0743:Sec16a	UTSW	2	26419722	missense	possibly damaging	0.67
R1446:Sec16a	UTSW	2	26423567	missense	probably benign	0.00
R1466:Sec16a	UTSW	2	26431157	missense	probably damaging	0.98
R1466:Sec16a	UTSW	2	26431157	missense	probably damaging	0.98
R1524:Sec16a	UTSW	2	26428382	missense	probably damaging	1.00
R1584:Sec16a	UTSW	2	26431157	missense	probably damaging	0.98
R1649:Sec16a	UTSW	2	26425524	missense	probably damaging	1.00
R1744:Sec16a	UTSW	2	26439186	missense	probably damaging	1.00
R1959:Sec16a	UTSW	2	26430132	missense	probably benign	0.00
R1973:Sec16a	UTSW	2	26426489	missense	probably damaging	1.00
R2005:Sec16a	UTSW	2	26439080	missense	probably benign	0.27
R2073:Sec16a	UTSW	2	26440239	missense	probably damaging	1.00
R2074:Sec16a	UTSW	2	26440239	missense	probably damaging	1.00
R2075:Sec16a	UTSW	2	26440239	missense	probably damaging	1.00
R2151:Sec16a	UTSW	2	26413745	intron	probably benign
R2472:Sec16a	UTSW	2	26439936	missense	probably damaging	1.00
R2512:Sec16a	UTSW	2	26439025	missense	probably benign	0.00
R2520:Sec16a	UTSW	2	26441356	nonsense	probably null
R2571:Sec16a	UTSW	2	26439331	missense	probably benign	0.08
R3105:Sec16a	UTSW	2	26438421	missense	probably benign	0.14
R3508:Sec16a	UTSW	2	26425850	missense	probably damaging	1.00
R3809:Sec16a	UTSW	2	26441813	missense	possibly damaging	0.71
R3912:Sec16a	UTSW	2	26414387	missense	probably damaging	0.97
R4292:Sec16a	UTSW	2	26422155	missense	probably benign	0.01
R4293:Sec16a	UTSW	2	26422155	missense	probably benign	0.01
R4294:Sec16a	UTSW	2	26422155	missense	probably benign	0.01
R4576:Sec16a	UTSW	2	26431119	nonsense	probably null
R4611:Sec16a	UTSW	2	26441805	missense	probably benign	0.04
R4627:Sec16a	UTSW	2	26429393	missense	probably damaging	1.00
R4627:Sec16a	UTSW	2	26431068	splice site	probably null
R4662:Sec16a	UTSW	2	26430570	missense	probably damaging	1.00
R4665:Sec16a	UTSW	2	26412958	intron	probably benign
R4906:Sec16a	UTSW	2	26441967	unclassified	probably benign
R4967:Sec16a	UTSW	2	26412871	missense	probably benign	0.00
R4983:Sec16a	UTSW	2	26439519	missense	probably benign
R5033:Sec16a	UTSW	2	26419649	missense	probably benign	0.00
R5251:Sec16a	UTSW	2	26439345	missense	probably benign	0.00
R5391:Sec16a	UTSW	2	26440032	missense	possibly damaging	0.82
R5457:Sec16a	UTSW	2	26440268	missense	probably benign	0.01
R5530:Sec16a	UTSW	2	26439252	missense	probably benign	0.00
R5645:Sec16a	UTSW	2	26439895	missense	probably benign	0.01
R5661:Sec16a	UTSW	2	26439637	missense	probably benign	0.01
R5770:Sec16a	UTSW	2	26414390	missense	probably damaging	0.99
R5830:Sec16a	UTSW	2	26440841	missense	probably benign	0.15
R5866:Sec16a	UTSW	2	26419638	missense	probably benign	0.00
R5875:Sec16a	UTSW	2	26433367	missense	probably damaging	1.00
R5906:Sec16a	UTSW	2	26438831	missense	possibly damaging	0.63
R5922:Sec16a	UTSW	2	26415639	missense	probably benign	0.05
R6076:Sec16a	UTSW	2	26423942	missense	probably damaging	1.00
R6091:Sec16a	UTSW	2	26426470	missense	probably damaging	1.00
R6295:Sec16a	UTSW	2	26428241	missense	probably damaging	1.00
R6302:Sec16a	UTSW	2	26425805	missense	probably damaging	1.00
R6309:Sec16a	UTSW	2	26438571	missense	probably benign	0.00
R6459:Sec16a	UTSW	2	26423500	missense	probably benign	0.04
R6520:Sec16a	UTSW	2	26426106	missense	probably damaging	1.00
R6631:Sec16a	UTSW	2	26439957	missense	probably damaging	1.00
R6657:Sec16a	UTSW	2	26425864	nonsense	probably null
R6750:Sec16a	UTSW	2	26440018	missense	probably benign	0.00
R6852:Sec16a	UTSW	2	26441419	missense	probably damaging	0.99
R6860:Sec16a	UTSW	2	26430112	missense	probably damaging	1.00
R6967:Sec16a	UTSW	2	26430486	missense	probably damaging	1.00
R6968:Sec16a	UTSW	2	26430486	missense	probably damaging	1.00
R6970:Sec16a	UTSW	2	26430486	missense	probably damaging	1.00
R6991:Sec16a	UTSW	2	26430486	missense	probably damaging	1.00
R6993:Sec16a	UTSW	2	26423574	missense	probably damaging	0.99
R7009:Sec16a	UTSW	2	26436002	nonsense	probably null
R7057:Sec16a	UTSW	2	26425265	missense	probably damaging	1.00
R7186:Sec16a	UTSW	2	26440703	nonsense	probably null
R7227:Sec16a	UTSW	2	26438923	missense	probably benign	0.01
R7234:Sec16a	UTSW	2	26439768	missense	probably damaging	1.00
R7259:Sec16a	UTSW	2	26441592	missense	probably benign	0.00
R7326:Sec16a	UTSW	2	26439717	missense	unknown
R7371:Sec16a	UTSW	2	26441722	missense	probably benign
R7388:Sec16a	UTSW	2	26428364	missense
R7414:Sec16a	UTSW	2	26423631	missense
R7417:Sec16a	UTSW	2	26421397	missense
R7501:Sec16a	UTSW	2	26441851	missense	probably damaging	1.00
R7558:Sec16a	UTSW	2	26439734	missense
R7696:Sec16a	UTSW	2	26415633	critical splice donor site	probably null
R7981:Sec16a	UTSW	2	26421372	critical splice donor site	probably null
R8117:Sec16a	UTSW	2	26441429	missense	probably benign	0.00
R8131:Sec16a	UTSW	2	26410946	missense
R8163:Sec16a	UTSW	2	26416421	missense
R8825:Sec16a	UTSW	2	26423574	missense
R8855:Sec16a	UTSW	2	26439840	missense	probably benign	0.16
R9165:Sec16a	UTSW	2	26423633	missense
R9216:Sec16a	UTSW	2	26414389	missense
R9283:Sec16a	UTSW	2	26423892	missense
R9506:Sec16a	UTSW	2	26429372	critical splice donor site	probably null
R9581:Sec16a	UTSW	2	26438635	missense
R9772:Sec16a	UTSW	2	26439405	missense	possibly damaging	0.87
X0011:Sec16a	UTSW	2	26415643	missense	probably damaging	1.00
X0034:Sec16a	UTSW	2	26416697	missense	probably benign	0.07
X0062:Sec16a	UTSW	2	26416697	missense	probably benign	0.07
Z1088:Sec16a	UTSW	2	26439093	missense	probably damaging	0.99
Z1176:Sec16a	UTSW	2	26438748	missense
Z1177:Sec16a	UTSW	2	26439321	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGTCCCTGCCGTGTTTGAAACC -3'
(R):5'- GTGGGCACATTCATTCAGCAAGAAG -3'

Sequencing Primer
(F):5'- GTTTGAAACCAGTTGCCCAG -3'
(R):5'- CTTCTCCTGTTGGAGGTGAAAC -3'

Posted On

2014-04-13