Incidental Mutation 'R1501:Med12l'
ID169243
Institutional Source Beutler Lab
Gene Symbol Med12l
Ensembl Gene ENSMUSG00000056476
Gene Namemediator complex subunit 12-like
Synonyms
MMRRC Submission 040867-MU
Accession Numbers

NCBI RefSeq: NM_177855.3; MGI: 2139916

Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R1501 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location59005825-59318682 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 59260835 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040325] [ENSMUST00000040325] [ENSMUST00000050360] [ENSMUST00000164225] [ENSMUST00000164225] [ENSMUST00000199609] [ENSMUST00000199659] [ENSMUST00000199659]
Predicted Effect probably null
Transcript: ENSMUST00000040325
SMART Domains Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 730 2.6e-207 PFAM
low complexity region 744 758 N/A INTRINSIC
low complexity region 853 872 N/A INTRINSIC
low complexity region 1455 1466 N/A INTRINSIC
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1769 1783 N/A INTRINSIC
Pfam:Med12-PQL 1803 2029 2.3e-14 PFAM
low complexity region 2055 2076 N/A INTRINSIC
low complexity region 2083 2101 N/A INTRINSIC
low complexity region 2116 2136 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000040325
SMART Domains Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 730 2.6e-207 PFAM
low complexity region 744 758 N/A INTRINSIC
low complexity region 853 872 N/A INTRINSIC
low complexity region 1455 1466 N/A INTRINSIC
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1769 1783 N/A INTRINSIC
Pfam:Med12-PQL 1803 2029 2.3e-14 PFAM
low complexity region 2055 2076 N/A INTRINSIC
low complexity region 2083 2101 N/A INTRINSIC
low complexity region 2116 2136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050360
SMART Domains Protein: ENSMUSP00000051353
Gene: ENSMUSG00000036353

DomainStartEndE-ValueType
Pfam:7tm_1 48 304 1.3e-40 PFAM
low complexity region 322 335 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164225
SMART Domains Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 283 765 5e-187 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1763 1777 N/A INTRINSIC
low complexity region 1804 1818 N/A INTRINSIC
Pfam:Med12-PQL 1840 2063 9.7e-66 PFAM
low complexity region 2090 2111 N/A INTRINSIC
low complexity region 2118 2136 N/A INTRINSIC
low complexity region 2151 2171 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164225
SMART Domains Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 283 765 5e-187 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1763 1777 N/A INTRINSIC
low complexity region 1804 1818 N/A INTRINSIC
Pfam:Med12-PQL 1840 2063 9.7e-66 PFAM
low complexity region 2090 2111 N/A INTRINSIC
low complexity region 2118 2136 N/A INTRINSIC
low complexity region 2151 2171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197374
Predicted Effect probably benign
Transcript: ENSMUST00000199609
SMART Domains Protein: ENSMUSP00000143521
Gene: ENSMUSG00000036353

DomainStartEndE-ValueType
Pfam:7tm_1 23 304 1.5e-31 PFAM
low complexity region 322 335 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000199659
SMART Domains Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 765 5.5e-209 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1761 1775 N/A INTRINSIC
low complexity region 1802 1816 N/A INTRINSIC
Pfam:Med12-PQL 1836 2062 1.7e-15 PFAM
low complexity region 2088 2130 N/A INTRINSIC
low complexity region 2144 2164 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000199659
SMART Domains Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 765 5.5e-209 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1761 1775 N/A INTRINSIC
low complexity region 1802 1816 N/A INTRINSIC
Pfam:Med12-PQL 1836 2062 1.7e-15 PFAM
low complexity region 2088 2130 N/A INTRINSIC
low complexity region 2144 2164 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the Mediator complex, which is involved in transcriptional coactivation of nearly all RNA polymerase II-dependent genes. The Mediator complex links gene-specific transcriptional activators with the basal transcription machinery. [provided by RefSeq, May 2010]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 A T 14: 78,513,347 S533R probably benign Het
Amph C T 13: 19,104,291 Q317* probably null Het
Bach2 A G 4: 32,562,279 T249A possibly damaging Het
Cacna2d3 A G 14: 28,981,180 C845R probably damaging Het
Calml4 A G 9: 62,871,340 K12E probably benign Het
Chrd C T 16: 20,737,533 R615W probably damaging Het
Chst15 T A 7: 132,269,069 K246* probably null Het
Cmtr2 G A 8: 110,221,603 D182N probably benign Het
Cyp2d9 C A 15: 82,454,324 C186* probably null Het
Cyp3a13 G T 5: 137,911,630 probably null Het
Dcaf17 A T 2: 71,081,988 I320F probably damaging Het
Ddx10 T C 9: 53,233,997 I227V possibly damaging Het
Dlc1 G T 8: 36,938,148 N162K probably benign Het
Dnhd1 G A 7: 105,668,463 R455H probably benign Het
Drg2 G T 11: 60,464,853 A306S probably benign Het
Dsg1a A T 18: 20,332,019 R422S probably damaging Het
Ehbp1l1 A G 19: 5,716,424 V353A probably damaging Het
Emilin2 T C 17: 71,310,761 S34G probably benign Het
Enpp2 C A 15: 54,839,514 W862L probably damaging Het
Exoc2 T C 13: 30,935,502 I139V probably benign Het
Fhad1 C T 4: 141,964,625 R400H probably benign Het
Fv1 C T 4: 147,870,138 T387M probably damaging Het
Gatad1 T A 5: 3,643,701 D156V probably damaging Het
Gm4744 A G 6: 40,950,433 probably benign Het
Gm4799 G A 10: 82,954,635 noncoding transcript Het
Hadha A G 5: 30,128,806 F405S probably benign Het
Ifit3 T C 19: 34,588,251 V399A probably benign Het
Il1rapl1 G T X: 87,304,863 Y150* probably null Het
Kirrel T C 3: 87,090,472 E248G probably benign Het
Krt72 C A 15: 101,778,334 K392N probably damaging Het
Loxhd1 G A 18: 77,356,832 G309D probably damaging Het
Mc3r T G 2: 172,249,380 I174S probably benign Het
Me3 A G 7: 89,633,065 D52G probably benign Het
Mgat5 G A 1: 127,397,641 probably null Het
Mgea5 T C 19: 45,778,640 D99G probably null Het
Mphosph10 A T 7: 64,389,504 F239L probably damaging Het
Mrps7 T C 11: 115,604,197 S13P probably benign Het
Nexn T C 3: 152,237,686 T527A possibly damaging Het
Nlrp1b G A 11: 71,156,059 H1156Y probably damaging Het
Nostrin A G 2: 69,158,785 E120G probably damaging Het
Nsun2 A G 13: 69,631,587 E624G probably damaging Het
Olfr1189 G A 2: 88,592,148 V115I possibly damaging Het
Olfr495 A C 7: 108,396,082 K321Q probably benign Het
Olfr503 G A 7: 108,544,575 V15I probably benign Het
Olfr730 A G 14: 50,187,082 I45T probably damaging Het
Phldb2 T C 16: 45,777,783 N802S probably damaging Het
Pik3c2g T C 6: 139,844,070 probably null Het
Pikfyve T A 1: 65,265,284 I1670N possibly damaging Het
Pld5 A G 1: 175,975,521 F393L probably benign Het
Plekhg1 C A 10: 3,957,361 D759E probably benign Het
Plekhm1 A G 11: 103,387,062 S403P probably benign Het
Pop1 T C 15: 34,510,357 F432L probably benign Het
Ptpn13 T C 5: 103,516,364 I406T probably benign Het
Ptpn5 G T 7: 47,089,875 D185E probably benign Het
Rad50 G T 11: 53,688,151 Q527K possibly damaging Het
Scn7a A G 2: 66,700,163 F613L probably benign Het
Sec16a T A 2: 26,440,045 M653L probably benign Het
Sh3bp2 T C 5: 34,555,576 probably null Het
Slc22a3 G A 17: 12,507,104 T74I probably benign Het
Slc23a4 A G 6: 34,955,122 L272P probably damaging Het
Slc26a8 T C 17: 28,638,562 D869G possibly damaging Het
Slc5a11 T A 7: 123,260,508 V291E probably damaging Het
Slc6a19 C A 13: 73,684,048 A470S probably benign Het
Slfn8 A G 11: 83,003,180 S878P probably damaging Het
Smchd1 A G 17: 71,365,094 M1655T possibly damaging Het
Srgap2 A G 1: 131,292,699 L179P probably damaging Het
Tbx2 A G 11: 85,834,796 D191G probably damaging Het
Tenm3 A G 8: 48,343,316 Y485H probably damaging Het
Trim12c T A 7: 104,340,888 probably benign Het
Trpc6 A G 9: 8,610,169 T213A probably damaging Het
Upp1 T A 11: 9,134,708 probably null Het
Vmn1r46 A T 6: 89,976,216 I16L probably benign Het
Vmn2r75 A T 7: 86,165,642 D214E possibly damaging Het
Vmn2r95 T A 17: 18,439,856 Y177N probably damaging Het
Vmn2r99 T G 17: 19,362,259 I42S possibly damaging Het
Zeb1 A T 18: 5,761,399 K232N possibly damaging Het
Zfp280b T C 10: 76,039,769 I494T probably damaging Het
Zfp804a A G 2: 82,235,799 D38G probably damaging Het
Other mutations in Med12l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Med12l APN 3 59042336 missense probably damaging 0.98
IGL00561:Med12l APN 3 59227824 missense probably benign
IGL00974:Med12l APN 3 59083014 missense probably damaging 1.00
IGL01024:Med12l APN 3 59073341 missense probably damaging 1.00
IGL01094:Med12l APN 3 59093655 missense probably damaging 0.99
IGL01134:Med12l APN 3 59042275 missense possibly damaging 0.91
IGL01535:Med12l APN 3 59262259 missense probably damaging 1.00
IGL01653:Med12l APN 3 59261893 missense probably damaging 1.00
IGL01735:Med12l APN 3 59263254 missense probably damaging 1.00
IGL01972:Med12l APN 3 59261893 missense probably damaging 1.00
IGL02005:Med12l APN 3 59244947 missense probably damaging 1.00
IGL02098:Med12l APN 3 59275855 missense possibly damaging 0.92
IGL02115:Med12l APN 3 59068319 missense probably benign 0.00
IGL02231:Med12l APN 3 59245882 missense probably damaging 1.00
IGL02259:Med12l APN 3 59245843 missense probably damaging 1.00
IGL02369:Med12l APN 3 59257373 missense probably benign 0.00
IGL02424:Med12l APN 3 59092722 missense probably benign 0.21
IGL02501:Med12l APN 3 59261976 missense possibly damaging 0.71
IGL02525:Med12l APN 3 59068368 missense probably benign 0.01
IGL02530:Med12l APN 3 59077089 missense probably damaging 1.00
IGL02735:Med12l APN 3 59093646 missense probably damaging 1.00
IGL02865:Med12l APN 3 59294292 missense probably damaging 1.00
IGL03183:Med12l APN 3 59037555 splice site probably null
IGL03264:Med12l APN 3 59301367 nonsense probably null
FR4304:Med12l UTSW 3 59275982 small insertion probably benign
FR4340:Med12l UTSW 3 59275985 small insertion probably benign
FR4342:Med12l UTSW 3 59275988 small insertion probably benign
FR4342:Med12l UTSW 3 59275994 small insertion probably benign
FR4449:Med12l UTSW 3 59275963 nonsense probably null
FR4548:Med12l UTSW 3 59275982 small insertion probably benign
FR4589:Med12l UTSW 3 59275956 small insertion probably benign
FR4976:Med12l UTSW 3 59275977 small insertion probably benign
P0007:Med12l UTSW 3 59091395 splice site probably benign
P0045:Med12l UTSW 3 59091535 missense probably damaging 0.99
R0030:Med12l UTSW 3 59248655 missense probably damaging 1.00
R0030:Med12l UTSW 3 59248655 missense probably damaging 1.00
R0148:Med12l UTSW 3 59037654 missense probably damaging 1.00
R0325:Med12l UTSW 3 59077059 missense possibly damaging 0.88
R0330:Med12l UTSW 3 59227702 missense probably damaging 1.00
R0388:Med12l UTSW 3 59093504 splice site probably benign
R0542:Med12l UTSW 3 59042401 missense probably damaging 1.00
R0624:Med12l UTSW 3 59037702 nonsense probably null
R0625:Med12l UTSW 3 59247437 missense probably damaging 1.00
R0671:Med12l UTSW 3 59264929 missense probably damaging 1.00
R0706:Med12l UTSW 3 59261980 missense probably damaging 1.00
R0785:Med12l UTSW 3 59260832 missense probably damaging 1.00
R1054:Med12l UTSW 3 59248651 missense probably damaging 0.99
R1102:Med12l UTSW 3 59244836 missense probably damaging 0.99
R1391:Med12l UTSW 3 59037738 missense probably benign 0.00
R1544:Med12l UTSW 3 59265240 missense possibly damaging 0.71
R1662:Med12l UTSW 3 59093617 missense probably damaging 1.00
R1670:Med12l UTSW 3 59275958 small insertion probably benign
R1839:Med12l UTSW 3 59068319 missense probably benign
R1854:Med12l UTSW 3 59260772 missense probably damaging 1.00
R2045:Med12l UTSW 3 59262310 nonsense probably null
R2070:Med12l UTSW 3 59244905 missense probably damaging 1.00
R2132:Med12l UTSW 3 59265282 unclassified probably null
R2290:Med12l UTSW 3 59244938 missense probably damaging 1.00
R2325:Med12l UTSW 3 59232454 missense probably damaging 0.99
R2352:Med12l UTSW 3 59240692 missense probably damaging 1.00
R2484:Med12l UTSW 3 59297838 missense probably benign 0.18
R2906:Med12l UTSW 3 59257082 missense probably damaging 1.00
R3735:Med12l UTSW 3 59091495 missense probably damaging 1.00
R3736:Med12l UTSW 3 59091495 missense probably damaging 1.00
R3774:Med12l UTSW 3 59247942 missense probably damaging 0.97
R3957:Med12l UTSW 3 59073168 missense probably damaging 0.99
R4020:Med12l UTSW 3 59247942 missense probably damaging 0.97
R4087:Med12l UTSW 3 59297921 missense probably benign 0.00
R4231:Med12l UTSW 3 59257223 splice site probably null
R4233:Med12l UTSW 3 59257223 splice site probably null
R4235:Med12l UTSW 3 59257223 splice site probably null
R4236:Med12l UTSW 3 59257223 splice site probably null
R4327:Med12l UTSW 3 59265267 missense probably benign 0.01
R4328:Med12l UTSW 3 59265267 missense probably benign 0.01
R4346:Med12l UTSW 3 59031555 missense probably damaging 1.00
R4543:Med12l UTSW 3 59091508 missense probably damaging 1.00
R4559:Med12l UTSW 3 59007102 critical splice donor site probably null
R4776:Med12l UTSW 3 59233212 missense probably damaging 1.00
R4877:Med12l UTSW 3 59244793 missense probably damaging 1.00
R4983:Med12l UTSW 3 59261929 missense probably damaging 1.00
R5114:Med12l UTSW 3 59259688 missense possibly damaging 0.85
R5125:Med12l UTSW 3 59267214 missense possibly damaging 0.83
R5230:Med12l UTSW 3 59245788 missense probably damaging 1.00
R5407:Med12l UTSW 3 59258201 missense probably damaging 1.00
R5426:Med12l UTSW 3 59248722 missense probably damaging 0.98
R5439:Med12l UTSW 3 59263213 missense probably null 1.00
R5449:Med12l UTSW 3 59259706 missense probably damaging 1.00
R5596:Med12l UTSW 3 59252350 missense probably benign 0.45
R5716:Med12l UTSW 3 59301377 critical splice donor site probably null
R5833:Med12l UTSW 3 59265226 missense possibly damaging 0.95
R5883:Med12l UTSW 3 59091468 missense probably damaging 1.00
R6264:Med12l UTSW 3 59256002 missense probably damaging 1.00
R6269:Med12l UTSW 3 59227822 missense probably damaging 1.00
R6394:Med12l UTSW 3 59235087 missense probably damaging 1.00
R6400:Med12l UTSW 3 59247911 missense probably damaging 1.00
R6475:Med12l UTSW 3 59257079 missense probably damaging 1.00
R6489:Med12l UTSW 3 59257407 missense probably damaging 0.99
R6654:Med12l UTSW 3 59262292 missense probably damaging 1.00
R6881:Med12l UTSW 3 59267165 missense probably benign 0.00
R7110:Med12l UTSW 3 59262224 missense possibly damaging 0.92
R7134:Med12l UTSW 3 59093759 nonsense probably null
R7137:Med12l UTSW 3 59258254 missense probably damaging 1.00
R7159:Med12l UTSW 3 59276017 missense probably benign
R7341:Med12l UTSW 3 59042403 missense possibly damaging 0.53
R7349:Med12l UTSW 3 59258325 missense probably damaging 1.00
R7413:Med12l UTSW 3 59091550 missense probably benign 0.00
R7495:Med12l UTSW 3 59244773 missense probably damaging 1.00
R7678:Med12l UTSW 3 59076720 missense probably damaging 1.00
R7697:Med12l UTSW 3 59240657 missense probably damaging 1.00
R7714:Med12l UTSW 3 59093586 missense probably benign 0.17
R7725:Med12l UTSW 3 59255992 missense probably damaging 1.00
X0062:Med12l UTSW 3 59233179 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTGCCATAGGCATTTCTGTGTG -3'
(R):5'- AGATCTGCCAGATGGAGCCTCTAC -3'

Sequencing Primer
(F):5'- gtgtgtgtgtgtAAGACTTTCTTC -3'
(R):5'- AGATGGAGCCTCTACTCCCTG -3'
Posted On2014-04-13