Incidental Mutation 'R1501:Bach2'
ID169247
Institutional Source Beutler Lab
Gene Symbol Bach2
Ensembl Gene ENSMUSG00000040270
Gene NameBTB and CNC homology, basic leucine zipper transcription factor 2
Synonyms
MMRRC Submission 040867-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1501 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location32238804-32586108 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32562279 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 249 (T249A)
Ref Sequence ENSEMBL: ENSMUSP00000131592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037416] [ENSMUST00000108180] [ENSMUST00000171600]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037416
AA Change: T249A

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000043693
Gene: ENSMUSG00000040270
AA Change: T249A

DomainStartEndE-ValueType
BTB 37 133 3.21e-28 SMART
low complexity region 276 287 N/A INTRINSIC
low complexity region 313 326 N/A INTRINSIC
low complexity region 328 343 N/A INTRINSIC
BRLZ 520 584 2.3e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108180
AA Change: T249A

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103815
Gene: ENSMUSG00000040270
AA Change: T249A

DomainStartEndE-ValueType
BTB 37 133 3.21e-28 SMART
low complexity region 276 287 N/A INTRINSIC
low complexity region 313 326 N/A INTRINSIC
low complexity region 328 343 N/A INTRINSIC
low complexity region 514 527 N/A INTRINSIC
BRLZ 643 707 2.3e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126225
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149084
Predicted Effect possibly damaging
Transcript: ENSMUST00000171600
AA Change: T249A

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131592
Gene: ENSMUSG00000040270
AA Change: T249A

DomainStartEndE-ValueType
BTB 37 133 3.21e-28 SMART
low complexity region 276 287 N/A INTRINSIC
low complexity region 313 326 N/A INTRINSIC
low complexity region 328 343 N/A INTRINSIC
low complexity region 514 527 N/A INTRINSIC
BRLZ 643 707 2.3e-14 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display impaired B cell differentiation and reduced B cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 A T 14: 78,513,347 S533R probably benign Het
Amph C T 13: 19,104,291 Q317* probably null Het
Cacna2d3 A G 14: 28,981,180 C845R probably damaging Het
Calml4 A G 9: 62,871,340 K12E probably benign Het
Chrd C T 16: 20,737,533 R615W probably damaging Het
Chst15 T A 7: 132,269,069 K246* probably null Het
Cmtr2 G A 8: 110,221,603 D182N probably benign Het
Cyp2d9 C A 15: 82,454,324 C186* probably null Het
Cyp3a13 G T 5: 137,911,630 probably null Het
Dcaf17 A T 2: 71,081,988 I320F probably damaging Het
Ddx10 T C 9: 53,233,997 I227V possibly damaging Het
Dlc1 G T 8: 36,938,148 N162K probably benign Het
Dnhd1 G A 7: 105,668,463 R455H probably benign Het
Drg2 G T 11: 60,464,853 A306S probably benign Het
Dsg1a A T 18: 20,332,019 R422S probably damaging Het
Ehbp1l1 A G 19: 5,716,424 V353A probably damaging Het
Emilin2 T C 17: 71,310,761 S34G probably benign Het
Enpp2 C A 15: 54,839,514 W862L probably damaging Het
Exoc2 T C 13: 30,935,502 I139V probably benign Het
Fhad1 C T 4: 141,964,625 R400H probably benign Het
Fv1 C T 4: 147,870,138 T387M probably damaging Het
Gatad1 T A 5: 3,643,701 D156V probably damaging Het
Gm4744 A G 6: 40,950,433 probably benign Het
Gm4799 G A 10: 82,954,635 noncoding transcript Het
Hadha A G 5: 30,128,806 F405S probably benign Het
Ifit3 T C 19: 34,588,251 V399A probably benign Het
Il1rapl1 G T X: 87,304,863 Y150* probably null Het
Kirrel T C 3: 87,090,472 E248G probably benign Het
Krt72 C A 15: 101,778,334 K392N probably damaging Het
Loxhd1 G A 18: 77,356,832 G309D probably damaging Het
Mc3r T G 2: 172,249,380 I174S probably benign Het
Me3 A G 7: 89,633,065 D52G probably benign Het
Med12l T C 3: 59,260,835 probably null Het
Mgat5 G A 1: 127,397,641 probably null Het
Mgea5 T C 19: 45,778,640 D99G probably null Het
Mphosph10 A T 7: 64,389,504 F239L probably damaging Het
Mrps7 T C 11: 115,604,197 S13P probably benign Het
Nexn T C 3: 152,237,686 T527A possibly damaging Het
Nlrp1b G A 11: 71,156,059 H1156Y probably damaging Het
Nostrin A G 2: 69,158,785 E120G probably damaging Het
Nsun2 A G 13: 69,631,587 E624G probably damaging Het
Olfr1189 G A 2: 88,592,148 V115I possibly damaging Het
Olfr495 A C 7: 108,396,082 K321Q probably benign Het
Olfr503 G A 7: 108,544,575 V15I probably benign Het
Olfr730 A G 14: 50,187,082 I45T probably damaging Het
Phldb2 T C 16: 45,777,783 N802S probably damaging Het
Pik3c2g T C 6: 139,844,070 probably null Het
Pikfyve T A 1: 65,265,284 I1670N possibly damaging Het
Pld5 A G 1: 175,975,521 F393L probably benign Het
Plekhg1 C A 10: 3,957,361 D759E probably benign Het
Plekhm1 A G 11: 103,387,062 S403P probably benign Het
Pop1 T C 15: 34,510,357 F432L probably benign Het
Ptpn13 T C 5: 103,516,364 I406T probably benign Het
Ptpn5 G T 7: 47,089,875 D185E probably benign Het
Rad50 G T 11: 53,688,151 Q527K possibly damaging Het
Scn7a A G 2: 66,700,163 F613L probably benign Het
Sec16a T A 2: 26,440,045 M653L probably benign Het
Sh3bp2 T C 5: 34,555,576 probably null Het
Slc22a3 G A 17: 12,507,104 T74I probably benign Het
Slc23a4 A G 6: 34,955,122 L272P probably damaging Het
Slc26a8 T C 17: 28,638,562 D869G possibly damaging Het
Slc5a11 T A 7: 123,260,508 V291E probably damaging Het
Slc6a19 C A 13: 73,684,048 A470S probably benign Het
Slfn8 A G 11: 83,003,180 S878P probably damaging Het
Smchd1 A G 17: 71,365,094 M1655T possibly damaging Het
Srgap2 A G 1: 131,292,699 L179P probably damaging Het
Tbx2 A G 11: 85,834,796 D191G probably damaging Het
Tenm3 A G 8: 48,343,316 Y485H probably damaging Het
Trim12c T A 7: 104,340,888 probably benign Het
Trpc6 A G 9: 8,610,169 T213A probably damaging Het
Upp1 T A 11: 9,134,708 probably null Het
Vmn1r46 A T 6: 89,976,216 I16L probably benign Het
Vmn2r75 A T 7: 86,165,642 D214E possibly damaging Het
Vmn2r95 T A 17: 18,439,856 Y177N probably damaging Het
Vmn2r99 T G 17: 19,362,259 I42S possibly damaging Het
Zeb1 A T 18: 5,761,399 K232N possibly damaging Het
Zfp280b T C 10: 76,039,769 I494T probably damaging Het
Zfp804a A G 2: 82,235,799 D38G probably damaging Het
Other mutations in Bach2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01749:Bach2 APN 4 32580261 missense probably damaging 1.00
IGL02137:Bach2 APN 4 32501621 start gained probably benign
IGL02281:Bach2 APN 4 32562513 missense possibly damaging 0.78
IGL02333:Bach2 APN 4 32575334 nonsense probably null
IGL02369:Bach2 APN 4 32579975 missense possibly damaging 0.85
IGL02533:Bach2 APN 4 32562451 missense probably benign 0.00
Magnificat UTSW 4 32563324 missense probably damaging 1.00
R0011:Bach2 UTSW 4 32244655 intron probably benign
R1240:Bach2 UTSW 4 32563198 missense probably damaging 1.00
R2004:Bach2 UTSW 4 32580055 missense probably benign 0.36
R2171:Bach2 UTSW 4 32501662 missense probably damaging 0.97
R3827:Bach2 UTSW 4 32563150 missense probably damaging 1.00
R3829:Bach2 UTSW 4 32563150 missense probably damaging 1.00
R3830:Bach2 UTSW 4 32563150 missense probably damaging 1.00
R4564:Bach2 UTSW 4 32563338 missense probably damaging 1.00
R4660:Bach2 UTSW 4 32562777 missense probably benign
R5132:Bach2 UTSW 4 32563396 intron probably benign
R5307:Bach2 UTSW 4 32562683 missense probably benign 0.11
R5491:Bach2 UTSW 4 32562681 missense probably damaging 1.00
R5860:Bach2 UTSW 4 32580268 missense probably damaging 1.00
R5983:Bach2 UTSW 4 32563324 missense probably damaging 1.00
R6331:Bach2 UTSW 4 32238816 start gained probably benign
R6770:Bach2 UTSW 4 32575240 missense possibly damaging 0.81
R6806:Bach2 UTSW 4 32575301 missense possibly damaging 0.66
R7146:Bach2 UTSW 4 32562670 missense probably damaging 1.00
R7691:Bach2 UTSW 4 32580271 missense probably damaging 1.00
R8062:Bach2 UTSW 4 32562937 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAAGAAGAAGCCCTGCTCCCTG -3'
(R):5'- GGACTCCACACCTTTCGTTATACCG -3'

Sequencing Primer
(F):5'- TGCTCCCTGAGTCTGAGG -3'
(R):5'- TTTCGTTATACCGAACAGAGACCG -3'
Posted On2014-04-13