Incidental Mutation 'R1501:Fhad1'
ID 169249
Institutional Source Beutler Lab
Gene Symbol Fhad1
Ensembl Gene ENSMUSG00000051435
Gene Name forkhead-associated (FHA) phosphopeptide binding domain 1
MMRRC Submission 040867-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R1501 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 141890438-142015082 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 141964625 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 400 (R400H)
Ref Sequence ENSEMBL: ENSMUSP00000101406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105779] [ENSMUST00000105780]
AlphaFold A6PWD2
Predicted Effect probably benign
Transcript: ENSMUST00000105779
AA Change: R400H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101405
Gene: ENSMUSG00000051435
AA Change: R400H

FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105780
AA Change: R400H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101406
Gene: ENSMUSG00000051435
AA Change: R400H

FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123068
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 A T 14: 78,513,347 S533R probably benign Het
Amph C T 13: 19,104,291 Q317* probably null Het
Bach2 A G 4: 32,562,279 T249A possibly damaging Het
Cacna2d3 A G 14: 28,981,180 C845R probably damaging Het
Calml4 A G 9: 62,871,340 K12E probably benign Het
Chrd C T 16: 20,737,533 R615W probably damaging Het
Chst15 T A 7: 132,269,069 K246* probably null Het
Cmtr2 G A 8: 110,221,603 D182N probably benign Het
Cyp2d9 C A 15: 82,454,324 C186* probably null Het
Cyp3a13 G T 5: 137,911,630 probably null Het
Dcaf17 A T 2: 71,081,988 I320F probably damaging Het
Ddx10 T C 9: 53,233,997 I227V possibly damaging Het
Dlc1 G T 8: 36,938,148 N162K probably benign Het
Dnhd1 G A 7: 105,668,463 R455H probably benign Het
Drg2 G T 11: 60,464,853 A306S probably benign Het
Dsg1a A T 18: 20,332,019 R422S probably damaging Het
Ehbp1l1 A G 19: 5,716,424 V353A probably damaging Het
Emilin2 T C 17: 71,310,761 S34G probably benign Het
Enpp2 C A 15: 54,839,514 W862L probably damaging Het
Exoc2 T C 13: 30,935,502 I139V probably benign Het
Fv1 C T 4: 147,870,138 T387M probably damaging Het
Gatad1 T A 5: 3,643,701 D156V probably damaging Het
Gm4744 A G 6: 40,950,433 probably benign Het
Gm4799 G A 10: 82,954,635 noncoding transcript Het
Hadha A G 5: 30,128,806 F405S probably benign Het
Ifit3 T C 19: 34,588,251 V399A probably benign Het
Il1rapl1 G T X: 87,304,863 Y150* probably null Het
Kirrel T C 3: 87,090,472 E248G probably benign Het
Krt72 C A 15: 101,778,334 K392N probably damaging Het
Loxhd1 G A 18: 77,356,832 G309D probably damaging Het
Mc3r T G 2: 172,249,380 I174S probably benign Het
Me3 A G 7: 89,633,065 D52G probably benign Het
Med12l T C 3: 59,260,835 probably null Het
Mgat5 G A 1: 127,397,641 probably null Het
Mgea5 T C 19: 45,778,640 D99G probably null Het
Mphosph10 A T 7: 64,389,504 F239L probably damaging Het
Mrps7 T C 11: 115,604,197 S13P probably benign Het
Nexn T C 3: 152,237,686 T527A possibly damaging Het
Nlrp1b G A 11: 71,156,059 H1156Y probably damaging Het
Nostrin A G 2: 69,158,785 E120G probably damaging Het
Nsun2 A G 13: 69,631,587 E624G probably damaging Het
Olfr1189 G A 2: 88,592,148 V115I possibly damaging Het
Olfr495 A C 7: 108,396,082 K321Q probably benign Het
Olfr503 G A 7: 108,544,575 V15I probably benign Het
Olfr730 A G 14: 50,187,082 I45T probably damaging Het
Phldb2 T C 16: 45,777,783 N802S probably damaging Het
Pik3c2g T C 6: 139,844,070 probably null Het
Pikfyve T A 1: 65,265,284 I1670N possibly damaging Het
Pld5 A G 1: 175,975,521 F393L probably benign Het
Plekhg1 C A 10: 3,957,361 D759E probably benign Het
Plekhm1 A G 11: 103,387,062 S403P probably benign Het
Pop1 T C 15: 34,510,357 F432L probably benign Het
Ptpn13 T C 5: 103,516,364 I406T probably benign Het
Ptpn5 G T 7: 47,089,875 D185E probably benign Het
Rad50 G T 11: 53,688,151 Q527K possibly damaging Het
Scn7a A G 2: 66,700,163 F613L probably benign Het
Sec16a T A 2: 26,440,045 M653L probably benign Het
Sh3bp2 T C 5: 34,555,576 probably null Het
Slc22a3 G A 17: 12,507,104 T74I probably benign Het
Slc23a4 A G 6: 34,955,122 L272P probably damaging Het
Slc26a8 T C 17: 28,638,562 D869G possibly damaging Het
Slc5a11 T A 7: 123,260,508 V291E probably damaging Het
Slc6a19 C A 13: 73,684,048 A470S probably benign Het
Slfn8 A G 11: 83,003,180 S878P probably damaging Het
Smchd1 A G 17: 71,365,094 M1655T possibly damaging Het
Srgap2 A G 1: 131,292,699 L179P probably damaging Het
Tbx2 A G 11: 85,834,796 D191G probably damaging Het
Tenm3 A G 8: 48,343,316 Y485H probably damaging Het
Trim12c T A 7: 104,340,888 probably benign Het
Trpc6 A G 9: 8,610,169 T213A probably damaging Het
Upp1 T A 11: 9,134,708 probably null Het
Vmn1r46 A T 6: 89,976,216 I16L probably benign Het
Vmn2r75 A T 7: 86,165,642 D214E possibly damaging Het
Vmn2r95 T A 17: 18,439,856 Y177N probably damaging Het
Vmn2r99 T G 17: 19,362,259 I42S possibly damaging Het
Zeb1 A T 18: 5,761,399 K232N possibly damaging Het
Zfp280b T C 10: 76,039,769 I494T probably damaging Het
Zfp804a A G 2: 82,235,799 D38G probably damaging Het
Other mutations in Fhad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Fhad1 APN 4 141905612 missense probably benign 0.02
IGL01478:Fhad1 APN 4 141951638 missense possibly damaging 0.84
IGL01752:Fhad1 APN 4 141972899 missense possibly damaging 0.82
IGL01788:Fhad1 APN 4 141932802 missense probably benign 0.00
IGL01919:Fhad1 APN 4 141964595 missense probably damaging 0.96
IGL02489:Fhad1 APN 4 141957620 missense probably damaging 0.97
IGL02568:Fhad1 APN 4 141932794 missense probably null 1.00
IGL02583:Fhad1 APN 4 142011644 utr 5 prime probably benign
IGL02716:Fhad1 APN 4 141918331 missense possibly damaging 0.89
IGL02819:Fhad1 APN 4 141918758 missense probably benign 0.23
IGL02820:Fhad1 APN 4 141918758 missense probably benign 0.23
IGL03038:Fhad1 APN 4 142002494 missense probably benign 0.38
IGL03167:Fhad1 APN 4 141972797 missense probably benign 0.00
IGL03255:Fhad1 APN 4 141972880 missense possibly damaging 0.79
R4466_Fhad1_343 UTSW 4 141957658 missense probably damaging 1.00
R4831_Fhad1_494 UTSW 4 141916067 splice site probably null
R5504_Fhad1_818 UTSW 4 141985535 missense probably benign
BB002:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
BB012:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
PIT1430001:Fhad1 UTSW 4 141909749 missense probably damaging 0.99
R0014:Fhad1 UTSW 4 141928408 missense probably damaging 1.00
R0116:Fhad1 UTSW 4 141940095 missense probably benign 0.06
R0143:Fhad1 UTSW 4 141929646 splice site probably benign
R0178:Fhad1 UTSW 4 141955340 missense probably benign 0.31
R0308:Fhad1 UTSW 4 141985593 splice site probably benign
R0384:Fhad1 UTSW 4 142002426 missense probably benign
R0583:Fhad1 UTSW 4 141903990 missense probably benign 0.37
R1584:Fhad1 UTSW 4 141985511 missense probably benign 0.22
R1615:Fhad1 UTSW 4 141922323 missense probably damaging 0.99
R1991:Fhad1 UTSW 4 141982162 missense possibly damaging 0.75
R2060:Fhad1 UTSW 4 141899249 missense probably benign 0.08
R2079:Fhad1 UTSW 4 141991202 nonsense probably null
R2133:Fhad1 UTSW 4 141928400 missense probably damaging 1.00
R2337:Fhad1 UTSW 4 141922344 missense possibly damaging 0.84
R2843:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2844:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2845:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2846:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2866:Fhad1 UTSW 4 141920788 missense probably benign 0.00
R3119:Fhad1 UTSW 4 141918307 frame shift probably null
R3760:Fhad1 UTSW 4 141909813 missense probably damaging 1.00
R4180:Fhad1 UTSW 4 141985543 missense possibly damaging 0.69
R4466:Fhad1 UTSW 4 141957658 missense probably damaging 1.00
R4627:Fhad1 UTSW 4 141896468 missense possibly damaging 0.47
R4680:Fhad1 UTSW 4 142011547 nonsense probably null
R4725:Fhad1 UTSW 4 141928378 critical splice donor site probably null
R4755:Fhad1 UTSW 4 141928483 missense probably damaging 1.00
R4831:Fhad1 UTSW 4 141916067 splice site probably null
R4909:Fhad1 UTSW 4 141985511 missense probably benign 0.01
R4968:Fhad1 UTSW 4 141918307 missense probably damaging 1.00
R5004:Fhad1 UTSW 4 142002599 critical splice acceptor site probably null
R5036:Fhad1 UTSW 4 141920741 missense probably benign 0.03
R5048:Fhad1 UTSW 4 141964676 critical splice acceptor site probably null
R5416:Fhad1 UTSW 4 141918802 missense probably benign 0.39
R5504:Fhad1 UTSW 4 141985535 missense probably benign
R5586:Fhad1 UTSW 4 141905131 missense probably benign 0.44
R5692:Fhad1 UTSW 4 141963457 missense probably benign 0.00
R5706:Fhad1 UTSW 4 141954116 missense probably damaging 1.00
R5773:Fhad1 UTSW 4 141929570 missense probably damaging 0.99
R5823:Fhad1 UTSW 4 141955306 missense possibly damaging 0.84
R5833:Fhad1 UTSW 4 142002527 missense probably damaging 1.00
R6170:Fhad1 UTSW 4 141890952 nonsense probably null
R6286:Fhad1 UTSW 4 141920898 missense probably damaging 1.00
R6610:Fhad1 UTSW 4 141916396 missense possibly damaging 0.94
R6755:Fhad1 UTSW 4 141964604 missense probably damaging 1.00
R7006:Fhad1 UTSW 4 141918291 frame shift probably null
R7008:Fhad1 UTSW 4 141918291 frame shift probably null
R7012:Fhad1 UTSW 4 141918291 frame shift probably null
R7014:Fhad1 UTSW 4 141918291 frame shift probably null
R7058:Fhad1 UTSW 4 141918291 frame shift probably null
R7059:Fhad1 UTSW 4 141918291 frame shift probably null
R7060:Fhad1 UTSW 4 141918291 frame shift probably null
R7159:Fhad1 UTSW 4 141951616 missense probably benign 0.01
R7472:Fhad1 UTSW 4 141964626 missense probably benign
R7670:Fhad1 UTSW 4 141951491 missense probably benign 0.01
R7694:Fhad1 UTSW 4 141905064 missense probably benign 0.41
R7745:Fhad1 UTSW 4 141890939 missense probably benign 0.00
R7848:Fhad1 UTSW 4 141905602 missense probably benign 0.29
R7853:Fhad1 UTSW 4 141909823 missense probably damaging 0.99
R7867:Fhad1 UTSW 4 141905591 missense probably benign 0.00
R7925:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
R8089:Fhad1 UTSW 4 141957660 missense probably damaging 1.00
R8123:Fhad1 UTSW 4 141985525 missense probably benign 0.02
R8711:Fhad1 UTSW 4 141957613 missense probably benign 0.25
R8751:Fhad1 UTSW 4 141918823 missense probably benign 0.04
R8783:Fhad1 UTSW 4 141909092 missense probably benign 0.02
R8858:Fhad1 UTSW 4 141939028 missense possibly damaging 0.87
R8867:Fhad1 UTSW 4 141929574 missense probably damaging 0.97
R8890:Fhad1 UTSW 4 141929591 missense probably benign 0.01
R8982:Fhad1 UTSW 4 142002584 missense probably damaging 1.00
R9004:Fhad1 UTSW 4 141922424 splice site probably benign
R9021:Fhad1 UTSW 4 141982309 missense probably damaging 0.97
R9190:Fhad1 UTSW 4 141918747 critical splice donor site probably null
R9237:Fhad1 UTSW 4 141905172 missense probably benign 0.11
X0018:Fhad1 UTSW 4 141951616 missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ggcaagaaggatggctcaac -3'
Posted On 2014-04-13