Incidental Mutation 'R1501:Tenm3'
ID169274
Institutional Source Beutler Lab
Gene Symbol Tenm3
Ensembl Gene ENSMUSG00000031561
Gene Nameteneurin transmembrane protein 3
SynonymsTen-m3, Odz3, 2610100B16Rik
MMRRC Submission 040867-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.606) question?
Stock #R1501 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location48227682-48843951 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48343316 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 485 (Y485H)
Ref Sequence ENSEMBL: ENSMUSP00000140141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033965] [ENSMUST00000110346] [ENSMUST00000190840]
Predicted Effect probably benign
Transcript: ENSMUST00000033965
AA Change: Y485H

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000033965
Gene: ENSMUSG00000031561
AA Change: Y485H

DomainStartEndE-ValueType
Pfam:Ten_N 11 177 6.9e-91 PFAM
Pfam:Ten_N 171 308 1e-72 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2631 2708 1.5e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110346
AA Change: Y213H

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000105975
Gene: ENSMUSG00000031561
AA Change: Y213H

DomainStartEndE-ValueType
Pfam:Ten_N 1 36 1.1e-14 PFAM
transmembrane domain 37 59 N/A INTRINSIC
EGF 245 273 2.32e-1 SMART
EGF_like 276 304 4.11e1 SMART
EGF 309 338 1.69e1 SMART
EGF 341 370 1.35e-2 SMART
EGF 375 405 6.11e-1 SMART
EGF 408 436 7.95e0 SMART
EGF 439 467 1.28e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190840
AA Change: Y485H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140141
Gene: ENSMUSG00000031561
AA Change: Y485H

DomainStartEndE-ValueType
Pfam:Ten_N 10 182 7.6e-77 PFAM
Pfam:Ten_N 168 308 6.6e-50 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2630 2708 3.2e-35 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large transmembrane protein that may be involved in the regulation of neuronal development. Mutation in this gene causes microphthalmia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null mutation display abnormal ipsilateral retinal ganglion cell projections and impaired performance in visually mediated behavioral tasks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 A T 14: 78,513,347 S533R probably benign Het
Amph C T 13: 19,104,291 Q317* probably null Het
Bach2 A G 4: 32,562,279 T249A possibly damaging Het
Cacna2d3 A G 14: 28,981,180 C845R probably damaging Het
Calml4 A G 9: 62,871,340 K12E probably benign Het
Chrd C T 16: 20,737,533 R615W probably damaging Het
Chst15 T A 7: 132,269,069 K246* probably null Het
Cmtr2 G A 8: 110,221,603 D182N probably benign Het
Cyp2d9 C A 15: 82,454,324 C186* probably null Het
Cyp3a13 G T 5: 137,911,630 probably null Het
Dcaf17 A T 2: 71,081,988 I320F probably damaging Het
Ddx10 T C 9: 53,233,997 I227V possibly damaging Het
Dlc1 G T 8: 36,938,148 N162K probably benign Het
Dnhd1 G A 7: 105,668,463 R455H probably benign Het
Drg2 G T 11: 60,464,853 A306S probably benign Het
Dsg1a A T 18: 20,332,019 R422S probably damaging Het
Ehbp1l1 A G 19: 5,716,424 V353A probably damaging Het
Emilin2 T C 17: 71,310,761 S34G probably benign Het
Enpp2 C A 15: 54,839,514 W862L probably damaging Het
Exoc2 T C 13: 30,935,502 I139V probably benign Het
Fhad1 C T 4: 141,964,625 R400H probably benign Het
Fv1 C T 4: 147,870,138 T387M probably damaging Het
Gatad1 T A 5: 3,643,701 D156V probably damaging Het
Gm4744 A G 6: 40,950,433 probably benign Het
Gm4799 G A 10: 82,954,635 noncoding transcript Het
Hadha A G 5: 30,128,806 F405S probably benign Het
Ifit3 T C 19: 34,588,251 V399A probably benign Het
Il1rapl1 G T X: 87,304,863 Y150* probably null Het
Kirrel T C 3: 87,090,472 E248G probably benign Het
Krt72 C A 15: 101,778,334 K392N probably damaging Het
Loxhd1 G A 18: 77,356,832 G309D probably damaging Het
Mc3r T G 2: 172,249,380 I174S probably benign Het
Me3 A G 7: 89,633,065 D52G probably benign Het
Med12l T C 3: 59,260,835 probably null Het
Mgat5 G A 1: 127,397,641 probably null Het
Mgea5 T C 19: 45,778,640 D99G probably null Het
Mphosph10 A T 7: 64,389,504 F239L probably damaging Het
Mrps7 T C 11: 115,604,197 S13P probably benign Het
Nexn T C 3: 152,237,686 T527A possibly damaging Het
Nlrp1b G A 11: 71,156,059 H1156Y probably damaging Het
Nostrin A G 2: 69,158,785 E120G probably damaging Het
Nsun2 A G 13: 69,631,587 E624G probably damaging Het
Olfr1189 G A 2: 88,592,148 V115I possibly damaging Het
Olfr495 A C 7: 108,396,082 K321Q probably benign Het
Olfr503 G A 7: 108,544,575 V15I probably benign Het
Olfr730 A G 14: 50,187,082 I45T probably damaging Het
Phldb2 T C 16: 45,777,783 N802S probably damaging Het
Pik3c2g T C 6: 139,844,070 probably null Het
Pikfyve T A 1: 65,265,284 I1670N possibly damaging Het
Pld5 A G 1: 175,975,521 F393L probably benign Het
Plekhg1 C A 10: 3,957,361 D759E probably benign Het
Plekhm1 A G 11: 103,387,062 S403P probably benign Het
Pop1 T C 15: 34,510,357 F432L probably benign Het
Ptpn13 T C 5: 103,516,364 I406T probably benign Het
Ptpn5 G T 7: 47,089,875 D185E probably benign Het
Rad50 G T 11: 53,688,151 Q527K possibly damaging Het
Scn7a A G 2: 66,700,163 F613L probably benign Het
Sec16a T A 2: 26,440,045 M653L probably benign Het
Sh3bp2 T C 5: 34,555,576 probably null Het
Slc22a3 G A 17: 12,507,104 T74I probably benign Het
Slc23a4 A G 6: 34,955,122 L272P probably damaging Het
Slc26a8 T C 17: 28,638,562 D869G possibly damaging Het
Slc5a11 T A 7: 123,260,508 V291E probably damaging Het
Slc6a19 C A 13: 73,684,048 A470S probably benign Het
Slfn8 A G 11: 83,003,180 S878P probably damaging Het
Smchd1 A G 17: 71,365,094 M1655T possibly damaging Het
Srgap2 A G 1: 131,292,699 L179P probably damaging Het
Tbx2 A G 11: 85,834,796 D191G probably damaging Het
Trim12c T A 7: 104,340,888 probably benign Het
Trpc6 A G 9: 8,610,169 T213A probably damaging Het
Upp1 T A 11: 9,134,708 probably null Het
Vmn1r46 A T 6: 89,976,216 I16L probably benign Het
Vmn2r75 A T 7: 86,165,642 D214E possibly damaging Het
Vmn2r95 T A 17: 18,439,856 Y177N probably damaging Het
Vmn2r99 T G 17: 19,362,259 I42S possibly damaging Het
Zeb1 A T 18: 5,761,399 K232N possibly damaging Het
Zfp280b T C 10: 76,039,769 I494T probably damaging Het
Zfp804a A G 2: 82,235,799 D38G probably damaging Het
Other mutations in Tenm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Tenm3 APN 8 48417060 missense probably damaging 1.00
IGL00538:Tenm3 APN 8 48236025 missense probably damaging 1.00
IGL00719:Tenm3 APN 8 48279042 missense probably benign 0.39
IGL00720:Tenm3 APN 8 48276421 missense probably damaging 0.98
IGL00870:Tenm3 APN 8 48417132 missense probably benign 0.00
IGL00976:Tenm3 APN 8 48256841 missense probably benign 0.14
IGL01469:Tenm3 APN 8 48236423 missense probably damaging 1.00
IGL01508:Tenm3 APN 8 48276645 missense probably benign 0.09
IGL01590:Tenm3 APN 8 48228802 missense probably damaging 1.00
IGL01610:Tenm3 APN 8 48254477 missense probably damaging 1.00
IGL01874:Tenm3 APN 8 48236758 nonsense probably null
IGL01892:Tenm3 APN 8 48276396 missense probably benign 0.09
IGL02098:Tenm3 APN 8 48276576 missense possibly damaging 0.94
IGL02382:Tenm3 APN 8 48235476 missense probably damaging 1.00
IGL02397:Tenm3 APN 8 48236694 missense possibly damaging 0.94
IGL02475:Tenm3 APN 8 48279198 splice site probably benign
IGL02502:Tenm3 APN 8 48288016 missense probably damaging 1.00
IGL02508:Tenm3 APN 8 48299639 missense probably benign 0.30
IGL02543:Tenm3 APN 8 48298956 missense probably damaging 1.00
IGL02723:Tenm3 APN 8 48276903 missense probably benign 0.02
IGL03037:Tenm3 APN 8 48298878 missense possibly damaging 0.90
IGL03160:Tenm3 APN 8 48646418 missense probably benign 0.05
IGL03268:Tenm3 APN 8 48235523 missense probably damaging 1.00
IGL02988:Tenm3 UTSW 8 48235346 missense probably damaging 0.99
PIT4431001:Tenm3 UTSW 8 48235607 missense probably damaging 1.00
PIT4504001:Tenm3 UTSW 8 48293657 missense probably damaging 1.00
R0079:Tenm3 UTSW 8 48343345 missense possibly damaging 0.90
R0121:Tenm3 UTSW 8 48342659 missense probably damaging 0.99
R0123:Tenm3 UTSW 8 48674472 missense probably damaging 1.00
R0134:Tenm3 UTSW 8 48674472 missense probably damaging 1.00
R0147:Tenm3 UTSW 8 48236720 missense probably damaging 1.00
R0148:Tenm3 UTSW 8 48236720 missense probably damaging 1.00
R0309:Tenm3 UTSW 8 48341034 missense probably damaging 1.00
R0322:Tenm3 UTSW 8 48236912 splice site probably benign
R0335:Tenm3 UTSW 8 48232105 missense probably damaging 1.00
R0355:Tenm3 UTSW 8 48228975 missense probably damaging 1.00
R0411:Tenm3 UTSW 8 48287791 missense possibly damaging 0.61
R0505:Tenm3 UTSW 8 48341160 splice site probably benign
R0573:Tenm3 UTSW 8 48674399 splice site probably benign
R0599:Tenm3 UTSW 8 48277710 missense probably damaging 1.00
R0616:Tenm3 UTSW 8 48276156 missense possibly damaging 0.76
R0637:Tenm3 UTSW 8 48236525 missense probably damaging 1.00
R0726:Tenm3 UTSW 8 48236594 missense probably damaging 1.00
R0840:Tenm3 UTSW 8 48335742 missense probably damaging 0.99
R0981:Tenm3 UTSW 8 48298965 missense probably damaging 1.00
R1006:Tenm3 UTSW 8 48228542 missense probably damaging 1.00
R1199:Tenm3 UTSW 8 48235582 missense probably damaging 0.99
R1223:Tenm3 UTSW 8 48240396 missense possibly damaging 0.72
R1240:Tenm3 UTSW 8 48287893 missense possibly damaging 0.74
R1394:Tenm3 UTSW 8 48276400 missense probably benign
R1455:Tenm3 UTSW 8 48279048 missense possibly damaging 0.87
R1459:Tenm3 UTSW 8 48235971 missense probably damaging 1.00
R1473:Tenm3 UTSW 8 48310625 missense probably damaging 1.00
R1507:Tenm3 UTSW 8 48287822 missense probably benign 0.01
R1522:Tenm3 UTSW 8 48395576 missense probably damaging 1.00
R1524:Tenm3 UTSW 8 48228981 missense possibly damaging 0.92
R1553:Tenm3 UTSW 8 48236421 missense probably damaging 1.00
R1572:Tenm3 UTSW 8 48228993 missense possibly damaging 0.94
R1583:Tenm3 UTSW 8 48279074 missense probably benign 0.09
R1676:Tenm3 UTSW 8 48417119 missense possibly damaging 0.83
R1732:Tenm3 UTSW 8 48310634 missense probably damaging 1.00
R1768:Tenm3 UTSW 8 48232104 missense probably damaging 1.00
R1777:Tenm3 UTSW 8 48417179 missense probably benign 0.05
R1793:Tenm3 UTSW 8 48674544 missense probably damaging 0.98
R1801:Tenm3 UTSW 8 48276256 missense probably benign 0.39
R1863:Tenm3 UTSW 8 48276346 missense probably benign 0.20
R1898:Tenm3 UTSW 8 48310761 missense probably damaging 1.00
R1971:Tenm3 UTSW 8 48236313 missense probably damaging 1.00
R1972:Tenm3 UTSW 8 48228591 missense probably damaging 1.00
R1996:Tenm3 UTSW 8 48228668 missense probably damaging 1.00
R2061:Tenm3 UTSW 8 48342256 critical splice donor site probably null
R2109:Tenm3 UTSW 8 48343349 missense possibly damaging 0.94
R2124:Tenm3 UTSW 8 48417006 critical splice donor site probably null
R2190:Tenm3 UTSW 8 48395544 missense probably damaging 1.00
R2204:Tenm3 UTSW 8 48674550 missense probably benign 0.17
R2233:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2234:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2235:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2237:Tenm3 UTSW 8 48342337 missense probably damaging 1.00
R2418:Tenm3 UTSW 8 48276658 missense possibly damaging 0.87
R2419:Tenm3 UTSW 8 48276658 missense possibly damaging 0.87
R2435:Tenm3 UTSW 8 48287953 missense probably damaging 1.00
R2483:Tenm3 UTSW 8 48240270 missense probably damaging 0.99
R3406:Tenm3 UTSW 8 48228555 missense probably damaging 1.00
R3724:Tenm3 UTSW 8 48277746 missense probably damaging 0.97
R4009:Tenm3 UTSW 8 48349223 missense probably damaging 1.00
R4210:Tenm3 UTSW 8 48349404 missense probably damaging 1.00
R4293:Tenm3 UTSW 8 48395658 missense probably damaging 1.00
R4656:Tenm3 UTSW 8 48293726 missense probably damaging 1.00
R4663:Tenm3 UTSW 8 48235970 missense probably damaging 1.00
R4835:Tenm3 UTSW 8 48313236 critical splice donor site probably null
R4851:Tenm3 UTSW 8 48310621 critical splice donor site probably null
R4867:Tenm3 UTSW 8 48235821 missense probably damaging 1.00
R4892:Tenm3 UTSW 8 48276861 missense probably damaging 0.99
R4895:Tenm3 UTSW 8 48300971 missense probably damaging 1.00
R4962:Tenm3 UTSW 8 48278961 nonsense probably null
R4995:Tenm3 UTSW 8 48229137 missense possibly damaging 0.87
R4996:Tenm3 UTSW 8 48235826 missense probably damaging 0.97
R5091:Tenm3 UTSW 8 48342308 missense probably benign 0.14
R5228:Tenm3 UTSW 8 48236355 missense probably damaging 1.00
R5253:Tenm3 UTSW 8 48229198 missense possibly damaging 0.92
R5260:Tenm3 UTSW 8 48236855 missense probably damaging 1.00
R5363:Tenm3 UTSW 8 48287831 missense possibly damaging 0.55
R5414:Tenm3 UTSW 8 48236355 missense probably damaging 1.00
R5427:Tenm3 UTSW 8 48236564 missense probably damaging 1.00
R5431:Tenm3 UTSW 8 48367377 nonsense probably null
R5566:Tenm3 UTSW 8 48279006 missense probably damaging 1.00
R5579:Tenm3 UTSW 8 48236764 missense probably damaging 1.00
R5656:Tenm3 UTSW 8 48228762 missense probably damaging 1.00
R5931:Tenm3 UTSW 8 48646498 missense probably benign 0.00
R5959:Tenm3 UTSW 8 48646447 nonsense probably null
R5965:Tenm3 UTSW 8 48228508 nonsense probably null
R6062:Tenm3 UTSW 8 48343406 missense possibly damaging 0.46
R6151:Tenm3 UTSW 8 48395573 missense probably damaging 1.00
R6157:Tenm3 UTSW 8 48298808 missense probably damaging 0.96
R6167:Tenm3 UTSW 8 48254622 missense possibly damaging 0.46
R6217:Tenm3 UTSW 8 48293665 missense probably damaging 0.99
R6233:Tenm3 UTSW 8 48417059 missense probably damaging 1.00
R6270:Tenm3 UTSW 8 48367394 missense probably damaging 0.98
R6329:Tenm3 UTSW 8 48276849 missense probably damaging 0.99
R6466:Tenm3 UTSW 8 48236063 missense probably damaging 0.97
R6515:Tenm3 UTSW 8 48417222 missense probably benign
R6516:Tenm3 UTSW 8 48417222 missense probably benign
R6747:Tenm3 UTSW 8 48343243 missense probably damaging 1.00
R6782:Tenm3 UTSW 8 48646256 critical splice donor site probably null
R6788:Tenm3 UTSW 8 48674493 missense probably damaging 1.00
R6823:Tenm3 UTSW 8 48256837 missense probably damaging 0.99
R6846:Tenm3 UTSW 8 48276738 missense probably benign 0.39
R6913:Tenm3 UTSW 8 48298937 missense probably damaging 0.99
R6941:Tenm3 UTSW 8 48674416 missense probably damaging 0.99
R6950:Tenm3 UTSW 8 48240479 nonsense probably null
R6968:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R6970:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R6993:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R7003:Tenm3 UTSW 8 48240444 missense probably damaging 1.00
R7125:Tenm3 UTSW 8 48674553 missense probably benign 0.00
R7140:Tenm3 UTSW 8 48292236 missense probably damaging 1.00
R7222:Tenm3 UTSW 8 48300969 missense probably damaging 1.00
R7232:Tenm3 UTSW 8 48235935 missense probably damaging 1.00
R7336:Tenm3 UTSW 8 48236177 missense possibly damaging 0.93
R7417:Tenm3 UTSW 8 48236183 missense probably damaging 1.00
R7526:Tenm3 UTSW 8 48287812 missense probably damaging 0.96
R7527:Tenm3 UTSW 8 48276600 missense possibly damaging 0.60
R7616:Tenm3 UTSW 8 48341049 missense possibly damaging 0.56
R7662:Tenm3 UTSW 8 48335727 missense probably benign 0.27
R7734:Tenm3 UTSW 8 48646333 missense probably damaging 1.00
R7802:Tenm3 UTSW 8 48236465 missense probably damaging 1.00
R7812:Tenm3 UTSW 8 48276300 missense probably benign 0.01
R7843:Tenm3 UTSW 8 48229111 nonsense probably null
R7926:Tenm3 UTSW 8 48229111 nonsense probably null
X0010:Tenm3 UTSW 8 48287829 missense probably damaging 0.98
X0025:Tenm3 UTSW 8 48236477 missense probably damaging 1.00
Z1177:Tenm3 UTSW 8 48276780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCACCAACGAGCAATTCACAGTG -3'
(R):5'- ATAGCTCGGCGTAGCAATGCAG -3'

Sequencing Primer
(F):5'- GCAATTCACAGTGTGTTCATTTTAC -3'
(R):5'- CAGGCATTGTTTCTGGATGCTAAC -3'
Posted On2014-04-13