Incidental Mutation 'R1501:Drg2'
ID169285
Institutional Source Beutler Lab
Gene Symbol Drg2
Ensembl Gene ENSMUSG00000020537
Gene Namedevelopmentally regulated GTP binding protein 2
Synonyms
MMRRC Submission 040867-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.935) question?
Stock #R1501 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location60454591-60468754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 60464853 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 306 (A306S)
Ref Sequence ENSEMBL: ENSMUSP00000018568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018568] [ENSMUST00000071880] [ENSMUST00000081823] [ENSMUST00000094135]
Predicted Effect probably benign
Transcript: ENSMUST00000018568
AA Change: A306S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000018568
Gene: ENSMUSG00000020537
AA Change: A306S

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:FeoB_N 63 169 1.4e-10 PFAM
Pfam:MMR_HSR1 64 180 1.5e-19 PFAM
Pfam:MMR_HSR1_Xtn 184 289 9.6e-50 PFAM
Pfam:TGS 290 363 2.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071880
SMART Domains Protein: ENSMUSP00000071777
Gene: ENSMUSG00000042678

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
low complexity region 269 292 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
low complexity region 349 384 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 509 N/A INTRINSIC
low complexity region 653 681 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 825 849 N/A INTRINSIC
low complexity region 883 897 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
MYSc 1200 1884 N/A SMART
IQ 1885 1907 1.63e-1 SMART
IQ 1908 1930 1.77e-2 SMART
IQ 1931 1953 2.97e2 SMART
low complexity region 1955 1974 N/A INTRINSIC
low complexity region 1992 2006 N/A INTRINSIC
MyTH4 2049 2195 1.8e-42 SMART
low complexity region 2396 2405 N/A INTRINSIC
low complexity region 2451 2461 N/A INTRINSIC
Blast:MYSc 2665 2848 2e-14 BLAST
SH3 2851 2933 1.55e-4 SMART
low complexity region 2949 2962 N/A INTRINSIC
MyTH4 3031 3185 5.59e-48 SMART
B41 3188 3400 6.94e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081823
SMART Domains Protein: ENSMUSP00000080507
Gene: ENSMUSG00000042678

DomainStartEndE-ValueType
MYSc 13 697 N/A SMART
IQ 698 720 1.63e-1 SMART
IQ 721 743 1.77e-2 SMART
IQ 744 766 2.97e2 SMART
low complexity region 787 801 N/A INTRINSIC
MyTH4 844 990 1.8e-42 SMART
low complexity region 1191 1200 N/A INTRINSIC
low complexity region 1246 1256 N/A INTRINSIC
Blast:MYSc 1460 1643 7e-15 BLAST
SH3 1646 1728 1.55e-4 SMART
low complexity region 1744 1757 N/A INTRINSIC
MyTH4 1826 1980 5.59e-48 SMART
B41 1983 2195 6.94e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094135
SMART Domains Protein: ENSMUSP00000091686
Gene: ENSMUSG00000042678

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
low complexity region 107 120 N/A INTRINSIC
low complexity region 269 292 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
low complexity region 311 325 N/A INTRINSIC
low complexity region 349 384 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 509 N/A INTRINSIC
low complexity region 653 681 N/A INTRINSIC
low complexity region 692 705 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 825 849 N/A INTRINSIC
low complexity region 883 897 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
MYSc 1200 1884 N/A SMART
IQ 1885 1907 1.63e-1 SMART
IQ 1908 1930 1.77e-2 SMART
IQ 1931 1953 2.97e2 SMART
low complexity region 1974 1988 N/A INTRINSIC
MyTH4 2031 2177 1.8e-42 SMART
low complexity region 2378 2387 N/A INTRINSIC
low complexity region 2433 2443 N/A INTRINSIC
Blast:MYSc 2647 2830 2e-14 BLAST
SH3 2833 2915 1.55e-4 SMART
low complexity region 2931 2944 N/A INTRINSIC
MyTH4 3013 3167 5.59e-48 SMART
B41 3170 3382 6.94e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138713
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155731
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTP-binding protein known to function in the regulation of cell growth and differentiation. Read-through transcripts containing this gene and a downstream gene have been identified, but they are not thought to encode a fusion protein. This gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 A T 14: 78,513,347 S533R probably benign Het
Amph C T 13: 19,104,291 Q317* probably null Het
Bach2 A G 4: 32,562,279 T249A possibly damaging Het
Cacna2d3 A G 14: 28,981,180 C845R probably damaging Het
Calml4 A G 9: 62,871,340 K12E probably benign Het
Chrd C T 16: 20,737,533 R615W probably damaging Het
Chst15 T A 7: 132,269,069 K246* probably null Het
Cmtr2 G A 8: 110,221,603 D182N probably benign Het
Cyp2d9 C A 15: 82,454,324 C186* probably null Het
Cyp3a13 G T 5: 137,911,630 probably null Het
Dcaf17 A T 2: 71,081,988 I320F probably damaging Het
Ddx10 T C 9: 53,233,997 I227V possibly damaging Het
Dlc1 G T 8: 36,938,148 N162K probably benign Het
Dnhd1 G A 7: 105,668,463 R455H probably benign Het
Dsg1a A T 18: 20,332,019 R422S probably damaging Het
Ehbp1l1 A G 19: 5,716,424 V353A probably damaging Het
Emilin2 T C 17: 71,310,761 S34G probably benign Het
Enpp2 C A 15: 54,839,514 W862L probably damaging Het
Exoc2 T C 13: 30,935,502 I139V probably benign Het
Fhad1 C T 4: 141,964,625 R400H probably benign Het
Fv1 C T 4: 147,870,138 T387M probably damaging Het
Gatad1 T A 5: 3,643,701 D156V probably damaging Het
Gm4744 A G 6: 40,950,433 probably benign Het
Gm4799 G A 10: 82,954,635 noncoding transcript Het
Hadha A G 5: 30,128,806 F405S probably benign Het
Ifit3 T C 19: 34,588,251 V399A probably benign Het
Il1rapl1 G T X: 87,304,863 Y150* probably null Het
Kirrel T C 3: 87,090,472 E248G probably benign Het
Krt72 C A 15: 101,778,334 K392N probably damaging Het
Loxhd1 G A 18: 77,356,832 G309D probably damaging Het
Mc3r T G 2: 172,249,380 I174S probably benign Het
Me3 A G 7: 89,633,065 D52G probably benign Het
Med12l T C 3: 59,260,835 probably null Het
Mgat5 G A 1: 127,397,641 probably null Het
Mgea5 T C 19: 45,778,640 D99G probably null Het
Mphosph10 A T 7: 64,389,504 F239L probably damaging Het
Mrps7 T C 11: 115,604,197 S13P probably benign Het
Nexn T C 3: 152,237,686 T527A possibly damaging Het
Nlrp1b G A 11: 71,156,059 H1156Y probably damaging Het
Nostrin A G 2: 69,158,785 E120G probably damaging Het
Nsun2 A G 13: 69,631,587 E624G probably damaging Het
Olfr1189 G A 2: 88,592,148 V115I possibly damaging Het
Olfr495 A C 7: 108,396,082 K321Q probably benign Het
Olfr503 G A 7: 108,544,575 V15I probably benign Het
Olfr730 A G 14: 50,187,082 I45T probably damaging Het
Phldb2 T C 16: 45,777,783 N802S probably damaging Het
Pik3c2g T C 6: 139,844,070 probably null Het
Pikfyve T A 1: 65,265,284 I1670N possibly damaging Het
Pld5 A G 1: 175,975,521 F393L probably benign Het
Plekhg1 C A 10: 3,957,361 D759E probably benign Het
Plekhm1 A G 11: 103,387,062 S403P probably benign Het
Pop1 T C 15: 34,510,357 F432L probably benign Het
Ptpn13 T C 5: 103,516,364 I406T probably benign Het
Ptpn5 G T 7: 47,089,875 D185E probably benign Het
Rad50 G T 11: 53,688,151 Q527K possibly damaging Het
Scn7a A G 2: 66,700,163 F613L probably benign Het
Sec16a T A 2: 26,440,045 M653L probably benign Het
Sh3bp2 T C 5: 34,555,576 probably null Het
Slc22a3 G A 17: 12,507,104 T74I probably benign Het
Slc23a4 A G 6: 34,955,122 L272P probably damaging Het
Slc26a8 T C 17: 28,638,562 D869G possibly damaging Het
Slc5a11 T A 7: 123,260,508 V291E probably damaging Het
Slc6a19 C A 13: 73,684,048 A470S probably benign Het
Slfn8 A G 11: 83,003,180 S878P probably damaging Het
Smchd1 A G 17: 71,365,094 M1655T possibly damaging Het
Srgap2 A G 1: 131,292,699 L179P probably damaging Het
Tbx2 A G 11: 85,834,796 D191G probably damaging Het
Tenm3 A G 8: 48,343,316 Y485H probably damaging Het
Trim12c T A 7: 104,340,888 probably benign Het
Trpc6 A G 9: 8,610,169 T213A probably damaging Het
Upp1 T A 11: 9,134,708 probably null Het
Vmn1r46 A T 6: 89,976,216 I16L probably benign Het
Vmn2r75 A T 7: 86,165,642 D214E possibly damaging Het
Vmn2r95 T A 17: 18,439,856 Y177N probably damaging Het
Vmn2r99 T G 17: 19,362,259 I42S possibly damaging Het
Zeb1 A T 18: 5,761,399 K232N possibly damaging Het
Zfp280b T C 10: 76,039,769 I494T probably damaging Het
Zfp804a A G 2: 82,235,799 D38G probably damaging Het
Other mutations in Drg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03019:Drg2 APN 11 60456595 missense probably damaging 1.00
R0356:Drg2 UTSW 11 60461581 missense probably damaging 0.97
R1483:Drg2 UTSW 11 60459527 missense probably damaging 1.00
R2517:Drg2 UTSW 11 60468128 missense probably damaging 0.96
R3434:Drg2 UTSW 11 60461392 nonsense probably null
R3824:Drg2 UTSW 11 60459508 missense possibly damaging 0.85
R3825:Drg2 UTSW 11 60459508 missense possibly damaging 0.85
R3898:Drg2 UTSW 11 60456634 missense probably benign
R4418:Drg2 UTSW 11 60468146 missense probably damaging 1.00
R4732:Drg2 UTSW 11 60461396 critical splice donor site probably null
R4733:Drg2 UTSW 11 60461396 critical splice donor site probably null
R4953:Drg2 UTSW 11 60459436 splice site probably benign
R5492:Drg2 UTSW 11 60461596 missense probably damaging 0.99
R6007:Drg2 UTSW 11 60462625 missense possibly damaging 0.55
R7282:Drg2 UTSW 11 60454693 missense probably benign 0.30
R7417:Drg2 UTSW 11 60454680 start codon destroyed probably null 0.77
R7697:Drg2 UTSW 11 60462177 missense probably damaging 0.98
R7822:Drg2 UTSW 11 60462200 nonsense probably null
R7911:Drg2 UTSW 11 60464175 missense possibly damaging 0.83
R8094:Drg2 UTSW 11 60462270 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGCTAGGCTCCAGCATTCATTC -3'
(R):5'- GTGTCCAATAGGCAGGTAAGCCAAG -3'

Sequencing Primer
(F):5'- CATGACATAGCACGAGATTCTG -3'
(R):5'- AGGCAAGCCTGCTTCAC -3'
Posted On2014-04-13