Mutagenetix > Incidental Mutation

Incidental Mutation 'R1501:Exoc2'

169294

Institutional Source

Beutler Lab

Gene Symbol

Exoc2

Ensembl Gene

ENSMUSG00000021357

Gene Name

exocyst complex component 2

Synonyms

2410030I24Rik, Sec5l1, Sec5

MMRRC Submission

040867-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.954) question?

Stock #

R1501 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30813919-30974093 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 30935502 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 139 (I139V)

Ref Sequence

ENSEMBL: ENSMUSP00000100010 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102946]

AlphaFold

Q9D4H1

Predicted Effect

probably benign
Transcript: ENSMUST00000021785
AA Change: I139V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357
AA Change: I139V

Domain	Start	End	E-Value	Type
Pfam:TIG	8	92	3.2e-10	PFAM
Pfam:Sec5	198	377	3.6e-59	PFAM
low complexity region	572	585	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102946
AA Change: I139V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357
AA Change: I139V

Domain	Start	End	E-Value	Type
Pfam:TIG	8	92	2.5e-10	PFAM
Pfam:Sec5	198	377	7.5e-59	PFAM
low complexity region	572	585	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220532

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222133

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223216

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap11	A	T	14: 78,513,347	S533R	probably benign	Het
Amph	C	T	13: 19,104,291	Q317*	probably null	Het
Bach2	A	G	4: 32,562,279	T249A	possibly damaging	Het
Cacna2d3	A	G	14: 28,981,180	C845R	probably damaging	Het
Calml4	A	G	9: 62,871,340	K12E	probably benign	Het
Chrd	C	T	16: 20,737,533	R615W	probably damaging	Het
Chst15	T	A	7: 132,269,069	K246*	probably null	Het
Cmtr2	G	A	8: 110,221,603	D182N	probably benign	Het
Cyp2d9	C	A	15: 82,454,324	C186*	probably null	Het
Cyp3a13	G	T	5: 137,911,630		probably null	Het
Dcaf17	A	T	2: 71,081,988	I320F	probably damaging	Het
Ddx10	T	C	9: 53,233,997	I227V	possibly damaging	Het
Dlc1	G	T	8: 36,938,148	N162K	probably benign	Het
Dnhd1	G	A	7: 105,668,463	R455H	probably benign	Het
Drg2	G	T	11: 60,464,853	A306S	probably benign	Het
Dsg1a	A	T	18: 20,332,019	R422S	probably damaging	Het
Ehbp1l1	A	G	19: 5,716,424	V353A	probably damaging	Het
Emilin2	T	C	17: 71,310,761	S34G	probably benign	Het
Enpp2	C	A	15: 54,839,514	W862L	probably damaging	Het
Fhad1	C	T	4: 141,964,625	R400H	probably benign	Het
Fv1	C	T	4: 147,870,138	T387M	probably damaging	Het
Gatad1	T	A	5: 3,643,701	D156V	probably damaging	Het
Gm4744	A	G	6: 40,950,433		probably benign	Het
Gm4799	G	A	10: 82,954,635		noncoding transcript	Het
Hadha	A	G	5: 30,128,806	F405S	probably benign	Het
Ifit3	T	C	19: 34,588,251	V399A	probably benign	Het
Il1rapl1	G	T	X: 87,304,863	Y150*	probably null	Het
Kirrel	T	C	3: 87,090,472	E248G	probably benign	Het
Krt72	C	A	15: 101,778,334	K392N	probably damaging	Het
Loxhd1	G	A	18: 77,356,832	G309D	probably damaging	Het
Mc3r	T	G	2: 172,249,380	I174S	probably benign	Het
Me3	A	G	7: 89,633,065	D52G	probably benign	Het
Med12l	T	C	3: 59,260,835		probably null	Het
Mgat5	G	A	1: 127,397,641		probably null	Het
Mgea5	T	C	19: 45,778,640	D99G	probably null	Het
Mphosph10	A	T	7: 64,389,504	F239L	probably damaging	Het
Mrps7	T	C	11: 115,604,197	S13P	probably benign	Het
Nexn	T	C	3: 152,237,686	T527A	possibly damaging	Het
Nlrp1b	G	A	11: 71,156,059	H1156Y	probably damaging	Het
Nostrin	A	G	2: 69,158,785	E120G	probably damaging	Het
Nsun2	A	G	13: 69,631,587	E624G	probably damaging	Het
Olfr1189	G	A	2: 88,592,148	V115I	possibly damaging	Het
Olfr495	A	C	7: 108,396,082	K321Q	probably benign	Het
Olfr503	G	A	7: 108,544,575	V15I	probably benign	Het
Olfr730	A	G	14: 50,187,082	I45T	probably damaging	Het
Phldb2	T	C	16: 45,777,783	N802S	probably damaging	Het
Pik3c2g	T	C	6: 139,844,070		probably null	Het
Pikfyve	T	A	1: 65,265,284	I1670N	possibly damaging	Het
Pld5	A	G	1: 175,975,521	F393L	probably benign	Het
Plekhg1	C	A	10: 3,957,361	D759E	probably benign	Het
Plekhm1	A	G	11: 103,387,062	S403P	probably benign	Het
Pop1	T	C	15: 34,510,357	F432L	probably benign	Het
Ptpn13	T	C	5: 103,516,364	I406T	probably benign	Het
Ptpn5	G	T	7: 47,089,875	D185E	probably benign	Het
Rad50	G	T	11: 53,688,151	Q527K	possibly damaging	Het
Scn7a	A	G	2: 66,700,163	F613L	probably benign	Het
Sec16a	T	A	2: 26,440,045	M653L	probably benign	Het
Sh3bp2	T	C	5: 34,555,576		probably null	Het
Slc22a3	G	A	17: 12,507,104	T74I	probably benign	Het
Slc23a4	A	G	6: 34,955,122	L272P	probably damaging	Het
Slc26a8	T	C	17: 28,638,562	D869G	possibly damaging	Het
Slc5a11	T	A	7: 123,260,508	V291E	probably damaging	Het
Slc6a19	C	A	13: 73,684,048	A470S	probably benign	Het
Slfn8	A	G	11: 83,003,180	S878P	probably damaging	Het
Smchd1	A	G	17: 71,365,094	M1655T	possibly damaging	Het
Srgap2	A	G	1: 131,292,699	L179P	probably damaging	Het
Tbx2	A	G	11: 85,834,796	D191G	probably damaging	Het
Tenm3	A	G	8: 48,343,316	Y485H	probably damaging	Het
Trim12c	T	A	7: 104,340,888		probably benign	Het
Trpc6	A	G	9: 8,610,169	T213A	probably damaging	Het
Upp1	T	A	11: 9,134,708		probably null	Het
Vmn1r46	A	T	6: 89,976,216	I16L	probably benign	Het
Vmn2r75	A	T	7: 86,165,642	D214E	possibly damaging	Het
Vmn2r95	T	A	17: 18,439,856	Y177N	probably damaging	Het
Vmn2r99	T	G	17: 19,362,259	I42S	possibly damaging	Het
Zeb1	A	T	18: 5,761,399	K232N	possibly damaging	Het
Zfp280b	T	C	10: 76,039,769	I494T	probably damaging	Het
Zfp804a	A	G	2: 82,235,799	D38G	probably damaging	Het

Other mutations in Exoc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Exoc2	APN	13	30820626	missense	probably benign	0.17
IGL01839:Exoc2	APN	13	30906799	missense	probably damaging	1.00
IGL02092:Exoc2	APN	13	30875277	missense	probably benign	0.09
IGL02245:Exoc2	APN	13	30906859	missense	probably benign	0.10
IGL02267:Exoc2	APN	13	30815321	missense	probably benign
IGL02478:Exoc2	APN	13	30927420	missense	probably benign
IGL02500:Exoc2	APN	13	30911196	missense	probably damaging	1.00
IGL03081:Exoc2	APN	13	30900902	missense	probably benign	0.28
IGL03112:Exoc2	APN	13	30906587	splice site	probably benign
IGL03409:Exoc2	APN	13	30940737	utr 5 prime	probably benign
R0284:Exoc2	UTSW	13	30877625	splice site	probably benign
R0452:Exoc2	UTSW	13	30886327	splice site	probably benign
R0826:Exoc2	UTSW	13	30856797	critical splice acceptor site	probably null
R1251:Exoc2	UTSW	13	30886276	missense	probably benign	0.03
R1367:Exoc2	UTSW	13	30882273	nonsense	probably null
R1593:Exoc2	UTSW	13	30856761	missense	possibly damaging	0.64
R1839:Exoc2	UTSW	13	30906497	splice site	probably benign
R1872:Exoc2	UTSW	13	30822661	missense	probably benign	0.17
R2064:Exoc2	UTSW	13	30935561	missense	probably benign	0.00
R2070:Exoc2	UTSW	13	30815370	missense	probably benign	0.00
R2227:Exoc2	UTSW	13	30864884	missense	probably benign
R2507:Exoc2	UTSW	13	30882365	missense	possibly damaging	0.55
R3965:Exoc2	UTSW	13	30877582	missense	probably benign	0.00
R4601:Exoc2	UTSW	13	30882268	missense	probably benign	0.05
R4914:Exoc2	UTSW	13	30876813	missense	probably benign	0.21
R5299:Exoc2	UTSW	13	30871918	splice site	probably null
R5410:Exoc2	UTSW	13	30864856	missense	probably damaging	0.98
R5461:Exoc2	UTSW	13	30925755	missense	possibly damaging	0.66
R5956:Exoc2	UTSW	13	30820623	missense	probably benign	0.03
R6056:Exoc2	UTSW	13	30900829	missense	probably benign	0.03
R6107:Exoc2	UTSW	13	30876797	missense	probably benign
R6548:Exoc2	UTSW	13	30826064	missense	possibly damaging	0.86
R6692:Exoc2	UTSW	13	30935507	missense	probably benign	0.09
R6969:Exoc2	UTSW	13	30911178	missense	probably benign
R7386:Exoc2	UTSW	13	30906663	splice site	probably null
R7461:Exoc2	UTSW	13	30882272	missense	probably benign	0.32
R7467:Exoc2	UTSW	13	30925733	missense	probably damaging	0.98
R7473:Exoc2	UTSW	13	30822630	critical splice donor site	probably null
R7613:Exoc2	UTSW	13	30882272	missense	probably benign	0.32
R7767:Exoc2	UTSW	13	30876769	missense	probably benign	0.01
R7793:Exoc2	UTSW	13	30911178	missense	probably benign	0.00
R7795:Exoc2	UTSW	13	30876773	nonsense	probably null
R7993:Exoc2	UTSW	13	30906730	critical splice donor site	probably null
R8085:Exoc2	UTSW	13	30940703	missense	probably damaging	1.00
R8330:Exoc2	UTSW	13	30877573	missense	probably benign
R8716:Exoc2	UTSW	13	30911244	missense	probably damaging	1.00
R8735:Exoc2	UTSW	13	30906839	missense	probably damaging	1.00
R8922:Exoc2	UTSW	13	30871855	missense	probably benign	0.05
R9237:Exoc2	UTSW	13	30864875	missense	probably benign
R9243:Exoc2	UTSW	13	30925795	missense	probably benign	0.03
R9365:Exoc2	UTSW	13	30856714	missense	probably benign	0.00
R9731:Exoc2	UTSW	13	30877250	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- GCCTATCATGTAAGAGTCACACATCCC -3'
(R):5'- TGTGGTGAGATGTCAAGGCACCTG -3'

Sequencing Primer
(F):5'- TCTGTGAAACCACTGACTGAAG -3'
(R):5'- TCAAGGCACCTGGAGAGTC -3'

Posted On

2014-04-13