Incidental Mutation 'R1501:Slc6a19'
ID 169296
Institutional Source Beutler Lab
Gene Symbol Slc6a19
Ensembl Gene ENSMUSG00000021565
Gene Name solute carrier family 6 (neurotransmitter transporter), member 19
Synonyms B<0>AT1, 4632401C08Rik
MMRRC Submission 040867-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R1501 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 73679745-73704865 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 73684048 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 470 (A470S)
Ref Sequence ENSEMBL: ENSMUSP00000022048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022048]
AlphaFold Q9D687
Predicted Effect probably benign
Transcript: ENSMUST00000022048
AA Change: A470S

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000022048
Gene: ENSMUSG00000021565
AA Change: A470S

DomainStartEndE-ValueType
Pfam:SNF 32 608 2.3e-180 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120322
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132085
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a system B(0) transmembrane protein that actively transports most neutral amino acids across the apical membrane of epithelial cells. Mutations in this gene result in Hartnup disorder. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and impaired amino acid absorption and excretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 A T 14: 78,513,347 S533R probably benign Het
Amph C T 13: 19,104,291 Q317* probably null Het
Bach2 A G 4: 32,562,279 T249A possibly damaging Het
Cacna2d3 A G 14: 28,981,180 C845R probably damaging Het
Calml4 A G 9: 62,871,340 K12E probably benign Het
Chrd C T 16: 20,737,533 R615W probably damaging Het
Chst15 T A 7: 132,269,069 K246* probably null Het
Cmtr2 G A 8: 110,221,603 D182N probably benign Het
Cyp2d9 C A 15: 82,454,324 C186* probably null Het
Cyp3a13 G T 5: 137,911,630 probably null Het
Dcaf17 A T 2: 71,081,988 I320F probably damaging Het
Ddx10 T C 9: 53,233,997 I227V possibly damaging Het
Dlc1 G T 8: 36,938,148 N162K probably benign Het
Dnhd1 G A 7: 105,668,463 R455H probably benign Het
Drg2 G T 11: 60,464,853 A306S probably benign Het
Dsg1a A T 18: 20,332,019 R422S probably damaging Het
Ehbp1l1 A G 19: 5,716,424 V353A probably damaging Het
Emilin2 T C 17: 71,310,761 S34G probably benign Het
Enpp2 C A 15: 54,839,514 W862L probably damaging Het
Exoc2 T C 13: 30,935,502 I139V probably benign Het
Fhad1 C T 4: 141,964,625 R400H probably benign Het
Fv1 C T 4: 147,870,138 T387M probably damaging Het
Gatad1 T A 5: 3,643,701 D156V probably damaging Het
Gm4744 A G 6: 40,950,433 probably benign Het
Gm4799 G A 10: 82,954,635 noncoding transcript Het
Hadha A G 5: 30,128,806 F405S probably benign Het
Ifit3 T C 19: 34,588,251 V399A probably benign Het
Il1rapl1 G T X: 87,304,863 Y150* probably null Het
Kirrel T C 3: 87,090,472 E248G probably benign Het
Krt72 C A 15: 101,778,334 K392N probably damaging Het
Loxhd1 G A 18: 77,356,832 G309D probably damaging Het
Mc3r T G 2: 172,249,380 I174S probably benign Het
Me3 A G 7: 89,633,065 D52G probably benign Het
Med12l T C 3: 59,260,835 probably null Het
Mgat5 G A 1: 127,397,641 probably null Het
Mgea5 T C 19: 45,778,640 D99G probably null Het
Mphosph10 A T 7: 64,389,504 F239L probably damaging Het
Mrps7 T C 11: 115,604,197 S13P probably benign Het
Nexn T C 3: 152,237,686 T527A possibly damaging Het
Nlrp1b G A 11: 71,156,059 H1156Y probably damaging Het
Nostrin A G 2: 69,158,785 E120G probably damaging Het
Nsun2 A G 13: 69,631,587 E624G probably damaging Het
Olfr1189 G A 2: 88,592,148 V115I possibly damaging Het
Olfr495 A C 7: 108,396,082 K321Q probably benign Het
Olfr503 G A 7: 108,544,575 V15I probably benign Het
Olfr730 A G 14: 50,187,082 I45T probably damaging Het
Phldb2 T C 16: 45,777,783 N802S probably damaging Het
Pik3c2g T C 6: 139,844,070 probably null Het
Pikfyve T A 1: 65,265,284 I1670N possibly damaging Het
Pld5 A G 1: 175,975,521 F393L probably benign Het
Plekhg1 C A 10: 3,957,361 D759E probably benign Het
Plekhm1 A G 11: 103,387,062 S403P probably benign Het
Pop1 T C 15: 34,510,357 F432L probably benign Het
Ptpn13 T C 5: 103,516,364 I406T probably benign Het
Ptpn5 G T 7: 47,089,875 D185E probably benign Het
Rad50 G T 11: 53,688,151 Q527K possibly damaging Het
Scn7a A G 2: 66,700,163 F613L probably benign Het
Sec16a T A 2: 26,440,045 M653L probably benign Het
Sh3bp2 T C 5: 34,555,576 probably null Het
Slc22a3 G A 17: 12,507,104 T74I probably benign Het
Slc23a4 A G 6: 34,955,122 L272P probably damaging Het
Slc26a8 T C 17: 28,638,562 D869G possibly damaging Het
Slc5a11 T A 7: 123,260,508 V291E probably damaging Het
Slfn8 A G 11: 83,003,180 S878P probably damaging Het
Smchd1 A G 17: 71,365,094 M1655T possibly damaging Het
Srgap2 A G 1: 131,292,699 L179P probably damaging Het
Tbx2 A G 11: 85,834,796 D191G probably damaging Het
Tenm3 A G 8: 48,343,316 Y485H probably damaging Het
Trim12c T A 7: 104,340,888 probably benign Het
Trpc6 A G 9: 8,610,169 T213A probably damaging Het
Upp1 T A 11: 9,134,708 probably null Het
Vmn1r46 A T 6: 89,976,216 I16L probably benign Het
Vmn2r75 A T 7: 86,165,642 D214E possibly damaging Het
Vmn2r95 T A 17: 18,439,856 Y177N probably damaging Het
Vmn2r99 T G 17: 19,362,259 I42S possibly damaging Het
Zeb1 A T 18: 5,761,399 K232N possibly damaging Het
Zfp280b T C 10: 76,039,769 I494T probably damaging Het
Zfp804a A G 2: 82,235,799 D38G probably damaging Het
Other mutations in Slc6a19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02401:Slc6a19 APN 13 73700590 missense probably damaging 1.00
IGL02425:Slc6a19 APN 13 73691800 missense probably benign 0.00
IGL03030:Slc6a19 APN 13 73700471 missense probably damaging 1.00
IGL03067:Slc6a19 APN 13 73689730 nonsense probably null
IGL03216:Slc6a19 APN 13 73686181 missense probably benign
IGL03330:Slc6a19 APN 13 73689560 missense possibly damaging 0.95
momentum UTSW 13 73681717 missense probably damaging 0.98
rifling UTSW 13 73685840 nonsense probably null
H8562:Slc6a19 UTSW 13 73700124 intron probably benign
R0107:Slc6a19 UTSW 13 73684057 missense possibly damaging 0.93
R0446:Slc6a19 UTSW 13 73691695 missense probably benign 0.01
R1422:Slc6a19 UTSW 13 73685869 missense probably benign 0.05
R1443:Slc6a19 UTSW 13 73684344 missense probably damaging 1.00
R1564:Slc6a19 UTSW 13 73686124 missense probably damaging 1.00
R1632:Slc6a19 UTSW 13 73689908 splice site probably null
R1832:Slc6a19 UTSW 13 73692950 missense probably benign
R2077:Slc6a19 UTSW 13 73700566 missense probably benign
R4418:Slc6a19 UTSW 13 73684395 missense possibly damaging 0.93
R4486:Slc6a19 UTSW 13 73681717 missense probably damaging 0.98
R4510:Slc6a19 UTSW 13 73683975 missense probably damaging 1.00
R4511:Slc6a19 UTSW 13 73683975 missense probably damaging 1.00
R4803:Slc6a19 UTSW 13 73684042 missense possibly damaging 0.91
R4965:Slc6a19 UTSW 13 73700558 missense probably benign 0.00
R4988:Slc6a19 UTSW 13 73685840 nonsense probably null
R5085:Slc6a19 UTSW 13 73691753 missense probably benign 0.11
R5533:Slc6a19 UTSW 13 73685829 missense possibly damaging 0.67
R5851:Slc6a19 UTSW 13 73691740 missense possibly damaging 0.55
R5874:Slc6a19 UTSW 13 73684368 missense probably damaging 0.98
R6074:Slc6a19 UTSW 13 73689763 missense probably benign 0.00
R6608:Slc6a19 UTSW 13 73683972 missense probably damaging 1.00
R7275:Slc6a19 UTSW 13 73686078 missense probably benign 0.11
R7386:Slc6a19 UTSW 13 73689891 missense possibly damaging 0.91
R7388:Slc6a19 UTSW 13 73693084 missense probably benign 0.30
R7393:Slc6a19 UTSW 13 73692974 missense probably benign 0.00
R7832:Slc6a19 UTSW 13 73693063 missense probably damaging 0.99
R7900:Slc6a19 UTSW 13 73700464 missense probably damaging 1.00
R8220:Slc6a19 UTSW 13 73685770 missense probably damaging 1.00
R8713:Slc6a19 UTSW 13 73700621 missense probably benign 0.19
R8977:Slc6a19 UTSW 13 73682150 missense probably benign
R9457:Slc6a19 UTSW 13 73681765 missense probably damaging 0.98
R9569:Slc6a19 UTSW 13 73685911 missense probably benign 0.00
R9662:Slc6a19 UTSW 13 73691703 nonsense probably null
Z1088:Slc6a19 UTSW 13 73689730 missense possibly damaging 0.82
Z1177:Slc6a19 UTSW 13 73684258 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GAAGGAAGTCTCCACTCTCTTGTGC -3'
(R):5'- ACGGAAGCCATCACGAAGATGC -3'

Sequencing Primer
(F):5'- GGCTCAGCTTACCAAAGATTCTG -3'
(R):5'- TCACGAAGATGCCAGTGTCC -3'
Posted On 2014-04-13