Incidental Mutation 'R1501:Slc26a8'
ID169309
Institutional Source Beutler Lab
Gene Symbol Slc26a8
Ensembl Gene ENSMUSG00000036196
Gene Namesolute carrier family 26, member 8
Synonyms
MMRRC Submission 040867-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.419) question?
Stock #R1501 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location28637783-28689987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28638562 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 869 (D869G)
Ref Sequence ENSEMBL: ENSMUSP00000110412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114764]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114764
AA Change: D869G

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110412
Gene: ENSMUSG00000036196
AA Change: D869G

DomainStartEndE-ValueType
Pfam:Sulfate_transp 90 491 1.2e-72 PFAM
low complexity region 494 509 N/A INTRINSIC
Pfam:STAS 542 792 7.3e-16 PFAM
low complexity region 881 896 N/A INTRINSIC
low complexity region 923 958 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC26 gene family of anion transporters. Family members are well conserved in gene structure and protein length yet have markedly different tissue expression patterns. The expression of this gene appears to be restricted to spermatocytes. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a targeted allele exhibit male sterility associated with sperm immotility, abnormal flagella and reduced acrosomal reaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 A T 14: 78,513,347 S533R probably benign Het
Amph C T 13: 19,104,291 Q317* probably null Het
Bach2 A G 4: 32,562,279 T249A possibly damaging Het
Cacna2d3 A G 14: 28,981,180 C845R probably damaging Het
Calml4 A G 9: 62,871,340 K12E probably benign Het
Chrd C T 16: 20,737,533 R615W probably damaging Het
Chst15 T A 7: 132,269,069 K246* probably null Het
Cmtr2 G A 8: 110,221,603 D182N probably benign Het
Cyp2d9 C A 15: 82,454,324 C186* probably null Het
Cyp3a13 G T 5: 137,911,630 probably null Het
Dcaf17 A T 2: 71,081,988 I320F probably damaging Het
Ddx10 T C 9: 53,233,997 I227V possibly damaging Het
Dlc1 G T 8: 36,938,148 N162K probably benign Het
Dnhd1 G A 7: 105,668,463 R455H probably benign Het
Drg2 G T 11: 60,464,853 A306S probably benign Het
Dsg1a A T 18: 20,332,019 R422S probably damaging Het
Ehbp1l1 A G 19: 5,716,424 V353A probably damaging Het
Emilin2 T C 17: 71,310,761 S34G probably benign Het
Enpp2 C A 15: 54,839,514 W862L probably damaging Het
Exoc2 T C 13: 30,935,502 I139V probably benign Het
Fhad1 C T 4: 141,964,625 R400H probably benign Het
Fv1 C T 4: 147,870,138 T387M probably damaging Het
Gatad1 T A 5: 3,643,701 D156V probably damaging Het
Gm4744 A G 6: 40,950,433 probably benign Het
Gm4799 G A 10: 82,954,635 noncoding transcript Het
Hadha A G 5: 30,128,806 F405S probably benign Het
Ifit3 T C 19: 34,588,251 V399A probably benign Het
Il1rapl1 G T X: 87,304,863 Y150* probably null Het
Kirrel T C 3: 87,090,472 E248G probably benign Het
Krt72 C A 15: 101,778,334 K392N probably damaging Het
Loxhd1 G A 18: 77,356,832 G309D probably damaging Het
Mc3r T G 2: 172,249,380 I174S probably benign Het
Me3 A G 7: 89,633,065 D52G probably benign Het
Med12l T C 3: 59,260,835 probably null Het
Mgat5 G A 1: 127,397,641 probably null Het
Mgea5 T C 19: 45,778,640 D99G probably null Het
Mphosph10 A T 7: 64,389,504 F239L probably damaging Het
Mrps7 T C 11: 115,604,197 S13P probably benign Het
Nexn T C 3: 152,237,686 T527A possibly damaging Het
Nlrp1b G A 11: 71,156,059 H1156Y probably damaging Het
Nostrin A G 2: 69,158,785 E120G probably damaging Het
Nsun2 A G 13: 69,631,587 E624G probably damaging Het
Olfr1189 G A 2: 88,592,148 V115I possibly damaging Het
Olfr495 A C 7: 108,396,082 K321Q probably benign Het
Olfr503 G A 7: 108,544,575 V15I probably benign Het
Olfr730 A G 14: 50,187,082 I45T probably damaging Het
Phldb2 T C 16: 45,777,783 N802S probably damaging Het
Pik3c2g T C 6: 139,844,070 probably null Het
Pikfyve T A 1: 65,265,284 I1670N possibly damaging Het
Pld5 A G 1: 175,975,521 F393L probably benign Het
Plekhg1 C A 10: 3,957,361 D759E probably benign Het
Plekhm1 A G 11: 103,387,062 S403P probably benign Het
Pop1 T C 15: 34,510,357 F432L probably benign Het
Ptpn13 T C 5: 103,516,364 I406T probably benign Het
Ptpn5 G T 7: 47,089,875 D185E probably benign Het
Rad50 G T 11: 53,688,151 Q527K possibly damaging Het
Scn7a A G 2: 66,700,163 F613L probably benign Het
Sec16a T A 2: 26,440,045 M653L probably benign Het
Sh3bp2 T C 5: 34,555,576 probably null Het
Slc22a3 G A 17: 12,507,104 T74I probably benign Het
Slc23a4 A G 6: 34,955,122 L272P probably damaging Het
Slc5a11 T A 7: 123,260,508 V291E probably damaging Het
Slc6a19 C A 13: 73,684,048 A470S probably benign Het
Slfn8 A G 11: 83,003,180 S878P probably damaging Het
Smchd1 A G 17: 71,365,094 M1655T possibly damaging Het
Srgap2 A G 1: 131,292,699 L179P probably damaging Het
Tbx2 A G 11: 85,834,796 D191G probably damaging Het
Tenm3 A G 8: 48,343,316 Y485H probably damaging Het
Trim12c T A 7: 104,340,888 probably benign Het
Trpc6 A G 9: 8,610,169 T213A probably damaging Het
Upp1 T A 11: 9,134,708 probably null Het
Vmn1r46 A T 6: 89,976,216 I16L probably benign Het
Vmn2r75 A T 7: 86,165,642 D214E possibly damaging Het
Vmn2r95 T A 17: 18,439,856 Y177N probably damaging Het
Vmn2r99 T G 17: 19,362,259 I42S possibly damaging Het
Zeb1 A T 18: 5,761,399 K232N possibly damaging Het
Zfp280b T C 10: 76,039,769 I494T probably damaging Het
Zfp804a A G 2: 82,235,799 D38G probably damaging Het
Other mutations in Slc26a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01466:Slc26a8 APN 17 28654948 missense probably benign 0.01
IGL02041:Slc26a8 APN 17 28642251 missense probably damaging 1.00
IGL02389:Slc26a8 APN 17 28638650 missense probably benign 0.00
E0370:Slc26a8 UTSW 17 28642387 missense possibly damaging 0.77
FR4449:Slc26a8 UTSW 17 28638316 small deletion probably benign
R1028:Slc26a8 UTSW 17 28672798 missense probably damaging 1.00
R1445:Slc26a8 UTSW 17 28648213 missense possibly damaging 0.72
R1606:Slc26a8 UTSW 17 28638481 missense possibly damaging 0.73
R1819:Slc26a8 UTSW 17 28684834 missense probably benign 0.31
R1950:Slc26a8 UTSW 17 28644640 missense probably benign 0.06
R1973:Slc26a8 UTSW 17 28663605 missense probably benign 0.01
R2203:Slc26a8 UTSW 17 28648007 missense probably benign 0.06
R3912:Slc26a8 UTSW 17 28644779 missense possibly damaging 0.92
R4176:Slc26a8 UTSW 17 28647999 missense probably benign 0.04
R4539:Slc26a8 UTSW 17 28659617 missense probably benign 0.00
R4661:Slc26a8 UTSW 17 28638684 missense probably benign 0.04
R4766:Slc26a8 UTSW 17 28638661 missense probably benign 0.01
R4850:Slc26a8 UTSW 17 28654883 missense probably benign 0.01
R4867:Slc26a8 UTSW 17 28663634 missense probably benign 0.05
R5521:Slc26a8 UTSW 17 28654859 missense probably benign 0.10
R5713:Slc26a8 UTSW 17 28661879 missense probably benign 0.01
R6092:Slc26a8 UTSW 17 28648155 missense probably damaging 1.00
R6135:Slc26a8 UTSW 17 28669940 missense probably benign 0.00
R6372:Slc26a8 UTSW 17 28644803 missense probably benign 0.08
R6543:Slc26a8 UTSW 17 28638401 missense possibly damaging 0.53
R6590:Slc26a8 UTSW 17 28644655 missense possibly damaging 0.52
R6690:Slc26a8 UTSW 17 28644655 missense possibly damaging 0.52
R6866:Slc26a8 UTSW 17 28638481 missense probably benign 0.27
R7057:Slc26a8 UTSW 17 28638397 missense possibly damaging 0.72
R7423:Slc26a8 UTSW 17 28648203 missense probably benign 0.32
R7496:Slc26a8 UTSW 17 28644850 missense probably benign 0.20
RF015:Slc26a8 UTSW 17 28638341 small deletion probably benign
Z1177:Slc26a8 UTSW 17 28638165 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCTCAAGCTCCGACTCTAGTTCCAG -3'
(R):5'- AGCGCCTTAGATGTCAGGATTGTG -3'

Sequencing Primer
(F):5'- CGACTCTAGTTCCAGCTCAGG -3'
(R):5'- atctgcctgcctctgcc -3'
Posted On2014-04-13