Incidental Mutation 'R1501:Smchd1'
ID 169311
Institutional Source Beutler Lab
Gene Symbol Smchd1
Ensembl Gene ENSMUSG00000024054
Gene Name SMC hinge domain containing 1
Synonyms MommeD1, 4931400A14Rik
MMRRC Submission 040867-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.838) question?
Stock # R1501 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 71651484-71782338 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 71672089 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 1655 (M1655T)
Ref Sequence ENSEMBL: ENSMUSP00000121835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127430]
AlphaFold Q6P5D8
Predicted Effect possibly damaging
Transcript: ENSMUST00000127430
AA Change: M1655T

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121835
Gene: ENSMUSG00000024054
AA Change: M1655T

DomainStartEndE-ValueType
Pfam:HATPase_c_3 139 299 6.8e-16 PFAM
low complexity region 451 457 N/A INTRINSIC
internal_repeat_1 859 1087 9.1e-5 PROSPERO
low complexity region 1185 1196 N/A INTRINSIC
internal_repeat_1 1205 1409 9.1e-5 PROSPERO
coiled coil region 1649 1680 N/A INTRINSIC
SMC_hinge 1721 1848 1.64e-15 SMART
low complexity region 1940 1954 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191623
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a hinge region domain found in members of the SMC (structural maintenance of chromosomes) protein family. [provided by RefSeq, Dec 2011]
PHENOTYPE: Females homozygous for an ENU-induced allele die at midgestation showing placental defects and hypomethylation at X-linked genes that are normally subject to X-inactivation, whereas homozygous males are viable. Females homozygous for a gene trap allele die before E13.5, whereas males remain healthy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 A T 14: 78,750,787 (GRCm39) S533R probably benign Het
Amph C T 13: 19,288,461 (GRCm39) Q317* probably null Het
Bach2 A G 4: 32,562,279 (GRCm39) T249A possibly damaging Het
Cacna2d3 A G 14: 28,703,137 (GRCm39) C845R probably damaging Het
Calml4 A G 9: 62,778,622 (GRCm39) K12E probably benign Het
Chrd C T 16: 20,556,283 (GRCm39) R615W probably damaging Het
Chst15 T A 7: 131,870,798 (GRCm39) K246* probably null Het
Cmtr2 G A 8: 110,948,235 (GRCm39) D182N probably benign Het
Cyp2d9 C A 15: 82,338,525 (GRCm39) C186* probably null Het
Cyp3a13 G T 5: 137,909,892 (GRCm39) probably null Het
Dcaf17 A T 2: 70,912,332 (GRCm39) I320F probably damaging Het
Ddx10 T C 9: 53,145,297 (GRCm39) I227V possibly damaging Het
Dlc1 G T 8: 37,405,302 (GRCm39) N162K probably benign Het
Dnhd1 G A 7: 105,317,670 (GRCm39) R455H probably benign Het
Drg2 G T 11: 60,355,679 (GRCm39) A306S probably benign Het
Dsg1a A T 18: 20,465,076 (GRCm39) R422S probably damaging Het
Ehbp1l1 A G 19: 5,766,452 (GRCm39) V353A probably damaging Het
Emilin2 T C 17: 71,617,756 (GRCm39) S34G probably benign Het
Enpp2 C A 15: 54,702,910 (GRCm39) W862L probably damaging Het
Exoc2 T C 13: 31,119,485 (GRCm39) I139V probably benign Het
Fhad1 C T 4: 141,691,936 (GRCm39) R400H probably benign Het
Fv1 C T 4: 147,954,595 (GRCm39) T387M probably damaging Het
Gatad1 T A 5: 3,693,701 (GRCm39) D156V probably damaging Het
Gm4744 A G 6: 40,927,367 (GRCm39) probably benign Het
Gm4799 G A 10: 82,790,469 (GRCm39) noncoding transcript Het
Hadha A G 5: 30,333,804 (GRCm39) F405S probably benign Het
Ifit3 T C 19: 34,565,651 (GRCm39) V399A probably benign Het
Il1rapl1 G T X: 86,348,469 (GRCm39) Y150* probably null Het
Kirrel1 T C 3: 86,997,779 (GRCm39) E248G probably benign Het
Krt72 C A 15: 101,686,769 (GRCm39) K392N probably damaging Het
Loxhd1 G A 18: 77,444,528 (GRCm39) G309D probably damaging Het
Mc3r T G 2: 172,091,300 (GRCm39) I174S probably benign Het
Me3 A G 7: 89,282,273 (GRCm39) D52G probably benign Het
Med12l T C 3: 59,168,256 (GRCm39) probably null Het
Mgat5 G A 1: 127,325,378 (GRCm39) probably null Het
Mphosph10 A T 7: 64,039,252 (GRCm39) F239L probably damaging Het
Mrps7 T C 11: 115,495,023 (GRCm39) S13P probably benign Het
Nexn T C 3: 151,943,323 (GRCm39) T527A possibly damaging Het
Nlrp1b G A 11: 71,046,885 (GRCm39) H1156Y probably damaging Het
Nostrin A G 2: 68,989,129 (GRCm39) E120G probably damaging Het
Nsun2 A G 13: 69,779,706 (GRCm39) E624G probably damaging Het
Oga T C 19: 45,767,079 (GRCm39) D99G probably null Het
Or4c102 G A 2: 88,422,492 (GRCm39) V115I possibly damaging Het
Or4k2 A G 14: 50,424,539 (GRCm39) I45T probably damaging Het
Or52n4b G A 7: 108,143,782 (GRCm39) V15I probably benign Het
Or5p70 A C 7: 107,995,289 (GRCm39) K321Q probably benign Het
Phldb2 T C 16: 45,598,146 (GRCm39) N802S probably damaging Het
Pik3c2g T C 6: 139,789,796 (GRCm39) probably null Het
Pikfyve T A 1: 65,304,443 (GRCm39) I1670N possibly damaging Het
Pld5 A G 1: 175,803,087 (GRCm39) F393L probably benign Het
Plekhg1 C A 10: 3,907,361 (GRCm39) D759E probably benign Het
Plekhm1 A G 11: 103,277,888 (GRCm39) S403P probably benign Het
Pop1 T C 15: 34,510,503 (GRCm39) F432L probably benign Het
Ptpn13 T C 5: 103,664,230 (GRCm39) I406T probably benign Het
Ptpn5 G T 7: 46,739,623 (GRCm39) D185E probably benign Het
Rad50 G T 11: 53,578,978 (GRCm39) Q527K possibly damaging Het
Scn7a A G 2: 66,530,507 (GRCm39) F613L probably benign Het
Sec16a T A 2: 26,330,057 (GRCm39) M653L probably benign Het
Sh3bp2 T C 5: 34,712,920 (GRCm39) probably null Het
Slc22a3 G A 17: 12,725,991 (GRCm39) T74I probably benign Het
Slc23a4 A G 6: 34,932,057 (GRCm39) L272P probably damaging Het
Slc26a8 T C 17: 28,857,536 (GRCm39) D869G possibly damaging Het
Slc5a11 T A 7: 122,859,731 (GRCm39) V291E probably damaging Het
Slc6a19 C A 13: 73,832,167 (GRCm39) A470S probably benign Het
Slfn8 A G 11: 82,894,006 (GRCm39) S878P probably damaging Het
Srgap2 A G 1: 131,220,437 (GRCm39) L179P probably damaging Het
Tbx2 A G 11: 85,725,622 (GRCm39) D191G probably damaging Het
Tenm3 A G 8: 48,796,351 (GRCm39) Y485H probably damaging Het
Trim12c T A 7: 103,990,095 (GRCm39) probably benign Het
Trpc6 A G 9: 8,610,170 (GRCm39) T213A probably damaging Het
Upp1 T A 11: 9,084,708 (GRCm39) probably null Het
Vmn1r46 A T 6: 89,953,198 (GRCm39) I16L probably benign Het
Vmn2r75 A T 7: 85,814,850 (GRCm39) D214E possibly damaging Het
Vmn2r95 T A 17: 18,660,118 (GRCm39) Y177N probably damaging Het
Vmn2r99 T G 17: 19,582,521 (GRCm39) I42S possibly damaging Het
Zeb1 A T 18: 5,761,399 (GRCm39) K232N possibly damaging Het
Zfp280b T C 10: 75,875,603 (GRCm39) I494T probably damaging Het
Zfp804a A G 2: 82,066,143 (GRCm39) D38G probably damaging Het
Other mutations in Smchd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Smchd1 APN 17 71,772,668 (GRCm39) splice site probably benign
IGL00529:Smchd1 APN 17 71,701,794 (GRCm39) missense probably benign 0.30
IGL00642:Smchd1 APN 17 71,697,427 (GRCm39) missense probably damaging 1.00
IGL00821:Smchd1 APN 17 71,705,618 (GRCm39) missense possibly damaging 0.92
IGL01330:Smchd1 APN 17 71,743,783 (GRCm39) missense probably benign
IGL01432:Smchd1 APN 17 71,738,285 (GRCm39) missense probably damaging 1.00
IGL01473:Smchd1 APN 17 71,696,745 (GRCm39) missense probably benign 0.00
IGL01705:Smchd1 APN 17 71,688,393 (GRCm39) missense probably damaging 1.00
IGL01787:Smchd1 APN 17 71,698,413 (GRCm39) missense probably damaging 0.99
IGL01814:Smchd1 APN 17 71,685,182 (GRCm39) missense probably benign 0.01
IGL01976:Smchd1 APN 17 71,701,720 (GRCm39) nonsense probably null
IGL01995:Smchd1 APN 17 71,751,015 (GRCm39) missense probably damaging 0.98
IGL02090:Smchd1 APN 17 71,738,248 (GRCm39) missense possibly damaging 0.86
IGL02302:Smchd1 APN 17 71,665,128 (GRCm39) splice site probably benign
IGL02309:Smchd1 APN 17 71,750,898 (GRCm39) missense probably benign 0.32
IGL02391:Smchd1 APN 17 71,738,254 (GRCm39) missense probably null 1.00
IGL02515:Smchd1 APN 17 71,747,952 (GRCm39) missense probably damaging 1.00
IGL02644:Smchd1 APN 17 71,667,016 (GRCm39) splice site probably benign
IGL03081:Smchd1 APN 17 71,667,186 (GRCm39) missense probably damaging 0.98
IGL03212:Smchd1 APN 17 71,750,886 (GRCm39) missense probably damaging 0.99
IGL03236:Smchd1 APN 17 71,698,425 (GRCm39) missense possibly damaging 0.88
IGL03297:Smchd1 APN 17 71,656,695 (GRCm39) missense probably benign 0.01
Dry_tortugas UTSW 17 71,747,951 (GRCm39) missense probably damaging 1.00
R0049:Smchd1 UTSW 17 71,738,231 (GRCm39) missense probably benign 0.01
R0254:Smchd1 UTSW 17 71,718,886 (GRCm39) missense probably benign 0.00
R0391:Smchd1 UTSW 17 71,710,149 (GRCm39) missense probably damaging 1.00
R0403:Smchd1 UTSW 17 71,701,897 (GRCm39) missense probably damaging 1.00
R0499:Smchd1 UTSW 17 71,694,083 (GRCm39) missense probably benign
R0520:Smchd1 UTSW 17 71,736,538 (GRCm39) missense possibly damaging 0.85
R0616:Smchd1 UTSW 17 71,686,569 (GRCm39) missense probably benign 0.39
R1120:Smchd1 UTSW 17 71,665,141 (GRCm39) nonsense probably null
R1469:Smchd1 UTSW 17 71,656,725 (GRCm39) missense probably damaging 1.00
R1469:Smchd1 UTSW 17 71,656,725 (GRCm39) missense probably damaging 1.00
R1473:Smchd1 UTSW 17 71,668,832 (GRCm39) splice site probably benign
R1484:Smchd1 UTSW 17 71,685,252 (GRCm39) missense probably benign 0.31
R1718:Smchd1 UTSW 17 71,755,828 (GRCm39) missense possibly damaging 0.46
R1765:Smchd1 UTSW 17 71,707,196 (GRCm39) splice site probably benign
R1766:Smchd1 UTSW 17 71,698,374 (GRCm39) missense probably damaging 0.99
R1803:Smchd1 UTSW 17 71,694,001 (GRCm39) missense probably damaging 0.99
R1829:Smchd1 UTSW 17 71,677,332 (GRCm39) missense probably damaging 1.00
R1850:Smchd1 UTSW 17 71,696,766 (GRCm39) missense probably damaging 0.99
R1917:Smchd1 UTSW 17 71,714,232 (GRCm39) missense possibly damaging 0.48
R1918:Smchd1 UTSW 17 71,714,232 (GRCm39) missense possibly damaging 0.48
R1936:Smchd1 UTSW 17 71,770,786 (GRCm39) missense probably damaging 1.00
R2024:Smchd1 UTSW 17 71,677,923 (GRCm39) missense probably benign 0.15
R2147:Smchd1 UTSW 17 71,705,583 (GRCm39) missense possibly damaging 0.93
R2180:Smchd1 UTSW 17 71,770,794 (GRCm39) missense probably benign 0.23
R2398:Smchd1 UTSW 17 71,733,431 (GRCm39) splice site probably benign
R2398:Smchd1 UTSW 17 71,667,136 (GRCm39) missense probably damaging 1.00
R2935:Smchd1 UTSW 17 71,718,900 (GRCm39) missense probably damaging 1.00
R3000:Smchd1 UTSW 17 71,670,033 (GRCm39) missense probably benign 0.00
R3021:Smchd1 UTSW 17 71,694,093 (GRCm39) missense possibly damaging 0.75
R3808:Smchd1 UTSW 17 71,736,536 (GRCm39) missense probably damaging 1.00
R4323:Smchd1 UTSW 17 71,735,270 (GRCm39) missense probably benign 0.00
R4486:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4487:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4488:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4489:Smchd1 UTSW 17 71,714,230 (GRCm39) missense probably benign 0.02
R4723:Smchd1 UTSW 17 71,743,742 (GRCm39) nonsense probably null
R4751:Smchd1 UTSW 17 71,698,463 (GRCm39) missense probably benign 0.01
R4798:Smchd1 UTSW 17 71,667,048 (GRCm39) nonsense probably null
R4814:Smchd1 UTSW 17 71,718,763 (GRCm39) critical splice donor site probably null
R4882:Smchd1 UTSW 17 71,665,234 (GRCm39) intron probably benign
R5088:Smchd1 UTSW 17 71,738,343 (GRCm39) missense possibly damaging 0.86
R5589:Smchd1 UTSW 17 71,747,956 (GRCm39) missense probably damaging 1.00
R5618:Smchd1 UTSW 17 71,762,722 (GRCm39) missense probably damaging 1.00
R5839:Smchd1 UTSW 17 71,701,857 (GRCm39) missense probably damaging 0.98
R5994:Smchd1 UTSW 17 71,672,404 (GRCm39) missense possibly damaging 0.89
R6009:Smchd1 UTSW 17 71,747,951 (GRCm39) missense probably damaging 1.00
R6042:Smchd1 UTSW 17 71,684,052 (GRCm39) nonsense probably null
R6082:Smchd1 UTSW 17 71,656,714 (GRCm39) missense probably benign 0.09
R6126:Smchd1 UTSW 17 71,677,280 (GRCm39) missense probably damaging 1.00
R6294:Smchd1 UTSW 17 71,677,922 (GRCm39) missense probably benign 0.13
R6788:Smchd1 UTSW 17 71,782,096 (GRCm39) missense probably benign 0.02
R6853:Smchd1 UTSW 17 71,743,738 (GRCm39) missense probably damaging 1.00
R6875:Smchd1 UTSW 17 71,660,501 (GRCm39) missense probably damaging 1.00
R7026:Smchd1 UTSW 17 71,656,662 (GRCm39) missense probably benign
R7045:Smchd1 UTSW 17 71,722,039 (GRCm39) missense probably benign 0.22
R7068:Smchd1 UTSW 17 71,694,087 (GRCm39) missense probably benign 0.00
R7085:Smchd1 UTSW 17 71,672,214 (GRCm39) splice site probably null
R7089:Smchd1 UTSW 17 71,668,955 (GRCm39) missense probably benign 0.00
R7145:Smchd1 UTSW 17 71,685,202 (GRCm39) missense probably benign
R7158:Smchd1 UTSW 17 71,707,145 (GRCm39) missense probably damaging 0.99
R7180:Smchd1 UTSW 17 71,701,818 (GRCm39) missense probably damaging 0.99
R7183:Smchd1 UTSW 17 71,660,511 (GRCm39) missense probably benign 0.00
R7214:Smchd1 UTSW 17 71,652,359 (GRCm39) missense probably benign 0.15
R7414:Smchd1 UTSW 17 71,782,074 (GRCm39) missense probably damaging 0.99
R7512:Smchd1 UTSW 17 71,688,364 (GRCm39) missense possibly damaging 0.51
R7631:Smchd1 UTSW 17 71,705,684 (GRCm39) missense probably benign 0.10
R7641:Smchd1 UTSW 17 71,697,474 (GRCm39) missense probably benign 0.00
R7709:Smchd1 UTSW 17 71,665,193 (GRCm39) missense probably damaging 1.00
R7768:Smchd1 UTSW 17 71,718,906 (GRCm39) missense probably damaging 1.00
R7789:Smchd1 UTSW 17 71,782,296 (GRCm39) start gained probably benign
R7898:Smchd1 UTSW 17 71,684,813 (GRCm39) splice site probably null
R7965:Smchd1 UTSW 17 71,762,621 (GRCm39) missense possibly damaging 0.65
R8177:Smchd1 UTSW 17 71,697,448 (GRCm39) missense probably benign 0.28
R8359:Smchd1 UTSW 17 71,738,238 (GRCm39) missense probably damaging 0.99
R8370:Smchd1 UTSW 17 71,701,908 (GRCm39) missense probably benign 0.22
R8426:Smchd1 UTSW 17 71,755,598 (GRCm39) missense probably damaging 1.00
R8443:Smchd1 UTSW 17 71,714,244 (GRCm39) missense probably benign 0.18
R8948:Smchd1 UTSW 17 71,743,767 (GRCm39) missense probably damaging 1.00
R8954:Smchd1 UTSW 17 71,755,752 (GRCm39) missense probably damaging 1.00
R9041:Smchd1 UTSW 17 71,701,710 (GRCm39) critical splice donor site probably null
R9054:Smchd1 UTSW 17 71,670,017 (GRCm39) nonsense probably null
R9141:Smchd1 UTSW 17 71,672,125 (GRCm39) missense probably benign 0.00
R9169:Smchd1 UTSW 17 71,722,659 (GRCm39) missense probably damaging 1.00
R9231:Smchd1 UTSW 17 71,672,084 (GRCm39) missense probably benign 0.05
R9368:Smchd1 UTSW 17 71,694,071 (GRCm39) missense probably damaging 1.00
R9374:Smchd1 UTSW 17 71,718,843 (GRCm39) missense possibly damaging 0.61
R9416:Smchd1 UTSW 17 71,701,791 (GRCm39) missense probably benign 0.27
R9426:Smchd1 UTSW 17 71,672,125 (GRCm39) missense probably benign 0.00
R9491:Smchd1 UTSW 17 71,667,020 (GRCm39) critical splice donor site probably null
R9511:Smchd1 UTSW 17 71,750,899 (GRCm39) missense possibly damaging 0.65
R9591:Smchd1 UTSW 17 71,701,828 (GRCm39) missense probably damaging 1.00
R9593:Smchd1 UTSW 17 71,701,828 (GRCm39) missense probably damaging 1.00
Z1176:Smchd1 UTSW 17 71,668,836 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGTGACATCTTTTGCCAGAAGC -3'
(R):5'- GGTGGTGCTGTAGATAACCTTGCTC -3'

Sequencing Primer
(F):5'- GACATCTTTTGCCAGAAGCTAGAAC -3'
(R):5'- TCATATGCATCATACTATGGCACAG -3'
Posted On 2014-04-13