Incidental Mutation 'R1502:Notch1'
ID169326
Institutional Source Beutler Lab
Gene Symbol Notch1
Ensembl Gene ENSMUSG00000026923
Gene Namenotch 1
SynonymsTan1, 9930111A19Rik, Mis6, Motch A, lin-12, N1
MMRRC Submission 039552-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1502 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location26457903-26516663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26484323 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 229 (N229K)
Ref Sequence ENSEMBL: ENSMUSP00000028288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028288] [ENSMUST00000132820]
PDB Structure
The Crystal Structure of a Partial Mouse Notch-1 Ankyrin Domain: Repeats 4 Through 7 Preserve an Ankyrin Fold [X-RAY DIFFRACTION]
Mouse Notch 1 Ankyrin Repeat Intracellular Domain [X-RAY DIFFRACTION]
Structure of sugar modified epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Structure of epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Structure of O-fucosylated epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Factor inhibiting HIF-1 Alpha in complex with Notch 1 fragment mouse notch (1930-1949) peptide [X-RAY DIFFRACTION]
Factor inhibiting HIF-1 Alpha in complex with Notch 1 fragment mouse notch (1997-2016) peptide [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028288
AA Change: N229K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028288
Gene: ENSMUSG00000026923
AA Change: N229K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EGF 23 58 1.63e1 SMART
EGF 62 99 4.29e-5 SMART
EGF 105 139 6.25e-7 SMART
EGF_CA 140 176 1.02e-6 SMART
EGF_CA 178 216 4.21e-13 SMART
EGF 221 255 6.7e-7 SMART
EGF_CA 257 293 6.8e-8 SMART
EGF_CA 295 333 1.16e-10 SMART
EGF_CA 335 371 3.17e-8 SMART
EGF 375 410 5.32e-1 SMART
EGF_CA 412 450 4.59e-14 SMART
EGF_CA 452 488 1.02e-11 SMART
EGF_CA 490 526 4.81e-8 SMART
EGF_CA 528 564 3.19e-13 SMART
EGF_CA 566 601 1.91e-11 SMART
EGF_CA 603 639 1.78e-11 SMART
EGF_CA 641 676 9.62e-8 SMART
EGF_CA 678 714 2.38e-12 SMART
EGF_CA 716 751 5.23e-9 SMART
EGF_CA 753 789 6.25e-7 SMART
EGF_CA 791 827 1.1e-11 SMART
EGF 832 867 2.03e-6 SMART
EGF_CA 869 905 5.73e-15 SMART
EGF_CA 907 943 4.56e-9 SMART
EGF_CA 945 981 1.64e-10 SMART
EGF_CA 983 1019 5.83e-7 SMART
EGF_CA 1021 1057 1.05e-13 SMART
EGF 1062 1095 8.12e-6 SMART
EGF 1100 1143 5.66e-5 SMART
EGF_CA 1145 1181 1.1e-11 SMART
EGF_CA 1183 1219 3.87e-12 SMART
EGF_CA 1221 1265 2.89e-11 SMART
EGF_CA 1267 1305 1.2e-8 SMART
EGF 1310 1346 5.74e-6 SMART
EGF 1351 1384 4.1e-2 SMART
EGF 1390 1426 2.66e-1 SMART
NL 1442 1480 4.08e-16 SMART
NL 1483 1522 1.08e-15 SMART
NL 1523 1562 7.39e-14 SMART
NOD 1566 1622 1.81e-32 SMART
NODP 1660 1722 3.27e-30 SMART
low complexity region 1729 1746 N/A INTRINSIC
ANK 1870 1912 1.07e2 SMART
ANK 1917 1946 4.82e-3 SMART
ANK 1950 1980 6.71e-2 SMART
ANK 1984 2013 1.23e0 SMART
ANK 2017 2046 9.13e-4 SMART
ANK 2050 2079 2.97e-3 SMART
low complexity region 2205 2222 N/A INTRINSIC
low complexity region 2364 2395 N/A INTRINSIC
DUF3454 2453 2517 2.01e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132820
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor plays a role in the development of numerous cell and tissue types. Mutations in this gene are associated with aortic valve disease, Adams-Oliver syndrome, T-cell acute lymphoblastic leukemia, chronic lymphocytic leukemia, and head and neck squamous cell carcinoma. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for null alleles exhibit defects in embryonic development resulting in lethality at some point in organogenesis. Lethal phenotype may be affected by genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T G 11: 109,974,645 T329P probably damaging Het
Adamts4 C A 1: 171,258,990 P784T probably damaging Het
Adamts6 T C 13: 104,493,637 L1096P probably damaging Het
Ap1b1 A G 11: 5,040,290 S849G probably benign Het
Arap2 T C 5: 62,604,404 S1660G probably benign Het
Atp10b A C 11: 43,230,347 T946P probably damaging Het
Brpf1 A G 6: 113,322,420 D1103G probably damaging Het
Bub1 A G 2: 127,827,419 Y102H probably damaging Het
C87499 T A 4: 88,628,032 I358F probably benign Het
Ccdc182 A G 11: 88,294,367 E91G probably benign Het
Cd200r4 C T 16: 44,833,440 T154M probably damaging Het
Cdh20 A G 1: 104,954,030 T407A probably benign Het
Col6a2 T C 10: 76,614,678 I140V probably benign Het
Csn3 C A 5: 87,930,124 T163K probably damaging Het
Dars2 A T 1: 161,046,805 L438* probably null Het
Dbr1 T C 9: 99,582,387 L289P probably damaging Het
Ddx46 A G 13: 55,663,309 R573G possibly damaging Het
Defb10 T C 8: 21,858,956 I10T possibly damaging Het
Dis3l T C 9: 64,325,787 E136G possibly damaging Het
Dnajb13 T C 7: 100,507,461 Q136R probably benign Het
Dse A T 10: 34,153,218 S625R probably damaging Het
Dvl3 A G 16: 20,523,459 D94G probably damaging Het
E130311K13Rik A C 3: 63,915,547 Y225* probably null Het
Etnppl A G 3: 130,628,789 I222V probably benign Het
Evc2 T C 5: 37,393,096 L818P probably benign Het
Fbn1 A T 2: 125,363,706 C1083* probably null Het
Flnc G A 6: 29,438,694 V196I probably benign Het
Fscn3 A G 6: 28,435,623 D415G probably benign Het
Gm3448 A G 17: 14,967,614 F133L probably benign Het
Gm4861 A C 3: 137,550,620 V75G probably damaging Het
Gpld1 A T 13: 24,971,416 T345S probably benign Het
Grik4 T C 9: 42,520,873 S943G probably damaging Het
Grik4 C T 9: 42,591,447 R460Q probably benign Het
Ifi207 A C 1: 173,729,306 L629R possibly damaging Het
Ift52 G A 2: 163,029,862 probably null Het
Insl3 A G 8: 71,690,232 D79G probably damaging Het
Kif5a A T 10: 127,245,441 I208N probably damaging Het
Lag3 T C 6: 124,909,243 Y249C probably damaging Het
Lipe T C 7: 25,398,147 N124D possibly damaging Het
Lnpep A G 17: 17,571,644 Y412H probably damaging Het
Lrtm2 A G 6: 119,317,274 Y299H probably benign Het
Lypd4 T C 7: 24,866,828 T24A probably benign Het
Magi1 T A 6: 93,694,170 I805F probably damaging Het
Mfap3 T C 11: 57,528,149 L45P probably benign Het
Nbea G A 3: 56,004,889 P1159L probably benign Het
Ndst4 A T 3: 125,437,758 probably benign Het
Nova1 A G 12: 46,720,832 I102T unknown Het
Npepps T C 11: 97,218,575 E725G possibly damaging Het
Olfr1157 T C 2: 87,962,035 N286D probably damaging Het
Olfr211 T C 6: 116,494,281 I224T probably damaging Het
Olfr743 A T 14: 50,533,777 M122L possibly damaging Het
Olfr822 T C 10: 130,074,872 I154T probably damaging Het
Pappa2 A T 1: 158,957,288 W51R probably damaging Het
Pde8a T C 7: 81,292,259 S149P probably damaging Het
Phkb T A 8: 86,059,339 L1052Q possibly damaging Het
Pou5f2 T A 13: 78,025,251 L104Q probably benign Het
Psme2b A T 11: 48,945,749 W124R probably damaging Het
Ptk2b G A 14: 66,163,080 S762L possibly damaging Het
Ptprs T C 17: 56,437,992 N248S probably benign Het
Rgs22 G A 15: 36,080,851 T705I probably damaging Het
Rnf123 T C 9: 108,068,510 probably null Het
Sel1l2 A T 2: 140,389,595 I13N probably damaging Het
Slc39a4 T C 15: 76,616,593 T57A probably benign Het
Smpdl3a T G 10: 57,809,091 V319G probably damaging Het
Syt9 T C 7: 107,436,487 L237P probably damaging Het
Tbc1d16 G T 11: 119,154,004 A536E probably damaging Het
Tcf20 T C 15: 82,855,576 D558G probably damaging Het
Tdpoz2 A T 3: 93,652,146 M173K probably benign Het
Tek A G 4: 94,781,102 I113M probably damaging Het
Tmem50a A T 4: 134,909,669 D50E probably benign Het
Tmem8 A G 17: 26,120,316 T535A possibly damaging Het
Trappc11 A T 8: 47,530,827 V10E possibly damaging Het
Vmn1r172 C T 7: 23,660,256 R189* probably null Het
Vmn2r63 A T 7: 42,928,591 D174E possibly damaging Het
Zc3h10 A T 10: 128,544,282 M402K probably damaging Het
Zfp109 T C 7: 24,228,163 H615R probably damaging Het
Zfp982 A C 4: 147,512,669 H161P probably benign Het
Zhx1 A G 15: 58,054,596 F85L probably damaging Het
Other mutations in Notch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Notch1 APN 2 26460046 missense probably damaging 0.98
IGL01343:Notch1 APN 2 26472905 missense probably benign 0.25
IGL02066:Notch1 APN 2 26460396 missense possibly damaging 0.71
IGL02158:Notch1 APN 2 26460339 missense probably damaging 1.00
IGL02541:Notch1 APN 2 26468503 missense probably benign 0.12
IGL03280:Notch1 APN 2 26477874 intron probably benign
IGL03338:Notch1 APN 2 26459959 missense probably benign
Antero UTSW 2 26476114 missense possibly damaging 0.96
march UTSW 2 26469899 missense probably damaging 0.98
PIT4494001:Notch1 UTSW 2 26466473 missense probably damaging 1.00
R0013:Notch1 UTSW 2 26473818 missense possibly damaging 0.64
R0025:Notch1 UTSW 2 26470931 missense probably damaging 1.00
R0129:Notch1 UTSW 2 26460458 missense probably benign 0.06
R0285:Notch1 UTSW 2 26460861 missense possibly damaging 0.88
R0531:Notch1 UTSW 2 26466572 missense probably benign 0.00
R0747:Notch1 UTSW 2 26472140 missense unknown
R1440:Notch1 UTSW 2 26480964 intron probably benign
R1539:Notch1 UTSW 2 26472113 nonsense probably null
R1623:Notch1 UTSW 2 26478612 missense possibly damaging 0.88
R1844:Notch1 UTSW 2 26460434 missense probably benign 0.12
R1863:Notch1 UTSW 2 26469950 missense probably damaging 1.00
R1874:Notch1 UTSW 2 26481579 missense possibly damaging 0.89
R1926:Notch1 UTSW 2 26481657 missense probably damaging 1.00
R2156:Notch1 UTSW 2 26460861 missense possibly damaging 0.91
R2196:Notch1 UTSW 2 26463804 nonsense probably null
R2209:Notch1 UTSW 2 26460007 missense probably benign
R2382:Notch1 UTSW 2 26473781 missense probably benign 0.40
R2508:Notch1 UTSW 2 26465473 missense possibly damaging 0.80
R2873:Notch1 UTSW 2 26460235 missense possibly damaging 0.89
R2874:Notch1 UTSW 2 26460235 missense possibly damaging 0.89
R3798:Notch1 UTSW 2 26478618 missense probably benign 0.00
R4019:Notch1 UTSW 2 26481142 missense probably benign 0.03
R4305:Notch1 UTSW 2 26477924 missense probably damaging 1.00
R4334:Notch1 UTSW 2 26460036 missense probably benign 0.22
R4504:Notch1 UTSW 2 26472177 missense probably benign 0.16
R4624:Notch1 UTSW 2 26478081 missense possibly damaging 0.94
R4659:Notch1 UTSW 2 26470889 missense probably damaging 0.99
R4703:Notch1 UTSW 2 26471158 missense probably benign
R4869:Notch1 UTSW 2 26471179 missense probably benign 0.21
R4938:Notch1 UTSW 2 26474124 nonsense probably null
R4989:Notch1 UTSW 2 26481181 missense probably damaging 1.00
R5010:Notch1 UTSW 2 26476114 missense possibly damaging 0.96
R5283:Notch1 UTSW 2 26468626 missense probably damaging 1.00
R5303:Notch1 UTSW 2 26478619 missense probably benign 0.01
R5635:Notch1 UTSW 2 26476161 missense probably damaging 1.00
R5755:Notch1 UTSW 2 26473692 missense probably benign 0.12
R5926:Notch1 UTSW 2 26476104 missense probably benign 0.35
R5947:Notch1 UTSW 2 26462528 intron probably benign
R6053:Notch1 UTSW 2 26472912 missense probably benign 0.06
R6161:Notch1 UTSW 2 26468731 missense probably damaging 1.00
R6162:Notch1 UTSW 2 26462195 missense probably benign
R6174:Notch1 UTSW 2 26485442 missense possibly damaging 0.50
R6199:Notch1 UTSW 2 26469899 missense probably damaging 0.98
R6209:Notch1 UTSW 2 26472805 missense probably damaging 1.00
R6251:Notch1 UTSW 2 26474170 missense possibly damaging 0.64
R6493:Notch1 UTSW 2 26472098 missense unknown
R6723:Notch1 UTSW 2 26478106 missense probably damaging 1.00
R6736:Notch1 UTSW 2 26460286 missense probably benign 0.01
R7020:Notch1 UTSW 2 26481574 missense possibly damaging 0.95
R7058:Notch1 UTSW 2 26463818 missense probably benign 0.05
R7154:Notch1 UTSW 2 26459938 missense probably benign
R7291:Notch1 UTSW 2 26476375 missense probably benign 0.01
R7379:Notch1 UTSW 2 26479467 missense probably damaging 1.00
R7560:Notch1 UTSW 2 26460165 missense probably benign 0.43
R7610:Notch1 UTSW 2 26478179 missense probably benign 0.13
R7833:Notch1 UTSW 2 26459533 makesense probably null
X0018:Notch1 UTSW 2 26462227 nonsense probably null
X0066:Notch1 UTSW 2 26470335 missense possibly damaging 0.90
Z1088:Notch1 UTSW 2 26477115 missense probably damaging 0.99
Z1177:Notch1 UTSW 2 26460309 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- ACTGAGAGTGTCCCCTCACTTCTG -3'
(R):5'- GCAAGATGTTAATGAGTGCAGCCAG -3'

Sequencing Primer
(F):5'- TGCTCTTATACCACACCTAAGGC -3'
(R):5'- TTAATGAGTGCAGCCAGAACCC -3'
Posted On2014-04-13