Incidental Mutation 'R1502:Bub1'
ID169329
Institutional Source Beutler Lab
Gene Symbol Bub1
Ensembl Gene ENSMUSG00000027379
Gene NameBUB1, mitotic checkpoint serine/threonine kinase
SynonymsD2Xrf87, Bub1a
MMRRC Submission 039552-MU
Accession Numbers

Genbank: NM_009772; MGI: 1100510

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1502 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location127801122-127831865 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127827419 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 102 (Y102H)
Ref Sequence ENSEMBL: ENSMUSP00000028858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028858]
Predicted Effect probably damaging
Transcript: ENSMUST00000028858
AA Change: Y102H

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028858
Gene: ENSMUSG00000027379
AA Change: Y102H

DomainStartEndE-ValueType
Mad3_BUB1_I 4 126 7.41e-46 SMART
low complexity region 216 225 N/A INTRINSIC
low complexity region 372 385 N/A INTRINSIC
Pfam:Pkinase_Tyr 762 1011 9.3e-10 PFAM
Pfam:Pkinase 762 1037 1.7e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133943
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine-protein kinase that play a central role in mitosis. The encoded protein functions in part by phosphorylating members of the mitotic checkpoint complex and activating the spindle checkpoint. This protein also plays a role in inhibiting the activation of the anaphase promoting complex/cyclosome. This protein may also function in the DNA damage response. Mutations in this gene have been associated with aneuploidy and several forms of cancer. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation exhibit embryonic lethality prior to implantation. Mice homozygous for a kinase dead allele exhibit aneuploidy in somatic and germ cells and reduced male fertility. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, knock-out(3) Targeted, other(4) Gene trapped(15)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T G 11: 109,974,645 T329P probably damaging Het
Adamts4 C A 1: 171,258,990 P784T probably damaging Het
Adamts6 T C 13: 104,493,637 L1096P probably damaging Het
Ap1b1 A G 11: 5,040,290 S849G probably benign Het
Arap2 T C 5: 62,604,404 S1660G probably benign Het
Atp10b A C 11: 43,230,347 T946P probably damaging Het
Brpf1 A G 6: 113,322,420 D1103G probably damaging Het
C87499 T A 4: 88,628,032 I358F probably benign Het
Ccdc182 A G 11: 88,294,367 E91G probably benign Het
Cd200r4 C T 16: 44,833,440 T154M probably damaging Het
Cdh20 A G 1: 104,954,030 T407A probably benign Het
Col6a2 T C 10: 76,614,678 I140V probably benign Het
Csn3 C A 5: 87,930,124 T163K probably damaging Het
Dars2 A T 1: 161,046,805 L438* probably null Het
Dbr1 T C 9: 99,582,387 L289P probably damaging Het
Ddx46 A G 13: 55,663,309 R573G possibly damaging Het
Defb10 T C 8: 21,858,956 I10T possibly damaging Het
Dis3l T C 9: 64,325,787 E136G possibly damaging Het
Dnajb13 T C 7: 100,507,461 Q136R probably benign Het
Dse A T 10: 34,153,218 S625R probably damaging Het
Dvl3 A G 16: 20,523,459 D94G probably damaging Het
E130311K13Rik A C 3: 63,915,547 Y225* probably null Het
Etnppl A G 3: 130,628,789 I222V probably benign Het
Evc2 T C 5: 37,393,096 L818P probably benign Het
Fbn1 A T 2: 125,363,706 C1083* probably null Het
Flnc G A 6: 29,438,694 V196I probably benign Het
Fscn3 A G 6: 28,435,623 D415G probably benign Het
Gm3448 A G 17: 14,967,614 F133L probably benign Het
Gm4861 A C 3: 137,550,620 V75G probably damaging Het
Gpld1 A T 13: 24,971,416 T345S probably benign Het
Grik4 T C 9: 42,520,873 S943G probably damaging Het
Grik4 C T 9: 42,591,447 R460Q probably benign Het
Ifi207 A C 1: 173,729,306 L629R possibly damaging Het
Ift52 G A 2: 163,029,862 probably null Het
Insl3 A G 8: 71,690,232 D79G probably damaging Het
Kif5a A T 10: 127,245,441 I208N probably damaging Het
Lag3 T C 6: 124,909,243 Y249C probably damaging Het
Lipe T C 7: 25,398,147 N124D possibly damaging Het
Lnpep A G 17: 17,571,644 Y412H probably damaging Het
Lrtm2 A G 6: 119,317,274 Y299H probably benign Het
Lypd4 T C 7: 24,866,828 T24A probably benign Het
Magi1 T A 6: 93,694,170 I805F probably damaging Het
Mfap3 T C 11: 57,528,149 L45P probably benign Het
Nbea G A 3: 56,004,889 P1159L probably benign Het
Ndst4 A T 3: 125,437,758 probably benign Het
Notch1 A T 2: 26,484,323 N229K possibly damaging Het
Nova1 A G 12: 46,720,832 I102T unknown Het
Npepps T C 11: 97,218,575 E725G possibly damaging Het
Olfr1157 T C 2: 87,962,035 N286D probably damaging Het
Olfr211 T C 6: 116,494,281 I224T probably damaging Het
Olfr743 A T 14: 50,533,777 M122L possibly damaging Het
Olfr822 T C 10: 130,074,872 I154T probably damaging Het
Pappa2 A T 1: 158,957,288 W51R probably damaging Het
Pde8a T C 7: 81,292,259 S149P probably damaging Het
Phkb T A 8: 86,059,339 L1052Q possibly damaging Het
Pou5f2 T A 13: 78,025,251 L104Q probably benign Het
Psme2b A T 11: 48,945,749 W124R probably damaging Het
Ptk2b G A 14: 66,163,080 S762L possibly damaging Het
Ptprs T C 17: 56,437,992 N248S probably benign Het
Rgs22 G A 15: 36,080,851 T705I probably damaging Het
Rnf123 T C 9: 108,068,510 probably null Het
Sel1l2 A T 2: 140,389,595 I13N probably damaging Het
Slc39a4 T C 15: 76,616,593 T57A probably benign Het
Smpdl3a T G 10: 57,809,091 V319G probably damaging Het
Syt9 T C 7: 107,436,487 L237P probably damaging Het
Tbc1d16 G T 11: 119,154,004 A536E probably damaging Het
Tcf20 T C 15: 82,855,576 D558G probably damaging Het
Tdpoz2 A T 3: 93,652,146 M173K probably benign Het
Tek A G 4: 94,781,102 I113M probably damaging Het
Tmem50a A T 4: 134,909,669 D50E probably benign Het
Tmem8 A G 17: 26,120,316 T535A possibly damaging Het
Trappc11 A T 8: 47,530,827 V10E possibly damaging Het
Vmn1r172 C T 7: 23,660,256 R189* probably null Het
Vmn2r63 A T 7: 42,928,591 D174E possibly damaging Het
Zc3h10 A T 10: 128,544,282 M402K probably damaging Het
Zfp109 T C 7: 24,228,163 H615R probably damaging Het
Zfp982 A C 4: 147,512,669 H161P probably benign Het
Zhx1 A G 15: 58,054,596 F85L probably damaging Het
Other mutations in Bub1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Bub1 APN 2 127829472 missense probably damaging 0.96
IGL00795:Bub1 APN 2 127821815 missense probably benign 0.00
IGL00966:Bub1 APN 2 127810663 missense probably damaging 1.00
IGL01807:Bub1 APN 2 127812977 missense probably benign 0.00
IGL02212:Bub1 APN 2 127805351 missense probably damaging 1.00
IGL02537:Bub1 APN 2 127801347 nonsense probably null
IGL02935:Bub1 APN 2 127801295 missense probably damaging 1.00
IGL03064:Bub1 APN 2 127817453 missense probably benign 0.00
R0052:Bub1 UTSW 2 127809039 missense probably benign 0.10
R0052:Bub1 UTSW 2 127809039 missense probably benign 0.10
R0325:Bub1 UTSW 2 127801394 nonsense probably null
R1627:Bub1 UTSW 2 127809013 missense probably benign 0.01
R1743:Bub1 UTSW 2 127813850 missense probably damaging 1.00
R1778:Bub1 UTSW 2 127803122 missense possibly damaging 0.60
R2043:Bub1 UTSW 2 127804220 missense probably damaging 1.00
R2108:Bub1 UTSW 2 127819335 missense probably damaging 0.99
R2165:Bub1 UTSW 2 127801281 missense probably benign 0.01
R2190:Bub1 UTSW 2 127810725 missense probably benign 0.06
R2507:Bub1 UTSW 2 127801423 missense probably benign 0.04
R2508:Bub1 UTSW 2 127801423 missense probably benign 0.04
R3836:Bub1 UTSW 2 127814886 missense probably damaging 1.00
R3862:Bub1 UTSW 2 127814756 splice site probably benign
R3904:Bub1 UTSW 2 127821942 missense probably benign 0.08
R4373:Bub1 UTSW 2 127805236 intron probably benign
R4580:Bub1 UTSW 2 127829676 critical splice donor site probably null
R4751:Bub1 UTSW 2 127823938 intron probably benign
R5239:Bub1 UTSW 2 127821696 missense probably damaging 1.00
R5498:Bub1 UTSW 2 127814709 missense possibly damaging 0.59
R5591:Bub1 UTSW 2 127819343 missense probably benign 0.16
R5672:Bub1 UTSW 2 127804880 missense possibly damaging 0.70
R5907:Bub1 UTSW 2 127819222 missense probably benign 0.02
R6714:Bub1 UTSW 2 127814732 missense probably benign 0.08
R6781:Bub1 UTSW 2 127807857 missense probably damaging 0.99
R6931:Bub1 UTSW 2 127801382 missense probably damaging 1.00
R7057:Bub1 UTSW 2 127829527 missense probably benign
R7094:Bub1 UTSW 2 127821761 missense probably null 0.99
Z1176:Bub1 UTSW 2 127829565 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCAGACCTACGACACAGATACTAC -3'
(R):5'- CTGGGAAAGAACTAGCCTAGCAGATTG -3'

Sequencing Primer
(F):5'- AAGACTTACAGTTAAAGTAGACACAC -3'
(R):5'- aacctctggcatttatcattttttg -3'
Posted On2014-04-13